TEAD3-TEA domain family member 3 Gene View larger

TEAD3-TEA domain family member 3 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TEAD3-TEA domain family member 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TEAD3-TEA domain family member 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027877
Product type: DNA & cDNA
Ncbi symbol: TEAD3
Origin species: Human
Product name: TEAD3-TEA domain family member 3 Gene
Size: 2ug
Accessions: BC027877
Gene id: 7005
Gene description: TEA domain family member 3
Synonyms: DTEF-1; ETFR-1; TEAD-3; TEAD5; TEF-5; TEF5; transcriptional enhancer factor TEF-5; TEA domain family member 3; TEA domain family member 5; transcriptional enhancer factor 5; transcriptional enhancer factor TEF-5 (DTEF-1); TEA domain transcription factor 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacctggaccaggtctccaaggacaaagcccttcagagcatggcgtccatgtcctctgcccagatcgtctctgccagtgtcctgcagaacaagttcagcccaccttcccctctgccccaggccgtcttctccacttcctcgcggttctggagcagcccccctctcctgggacagcagcctggaccctctcaggacatcaagccctttgcacagccagcctaccccatccagccgcccctgccgccgacgctcagcagttatgagcccctggccccgctcccctcagctgctgcctctgtgcctgtgtggcaggaccgtaccattgcctcctcccggctgcggctcctggagtattcagccttcatggaggtgcagcgagaccctgacacgtacagcaaacacctgtttgtgcacatcggccagacgaaccccgccttctcagacccacccctggaggcagtagatgtgcgccagatctatgacaaattccccgagaaaaagggaggattgaaggagctctatgagaaggggccccctaatgccttcttccttgtcaagttctgggccgacctcaacagcaccatccaggagggcccgggagccttctatggggtcagctctcagtacagctctgctgatagcatgaccatcagcgtctccaccaaggtgtgctcctttggcaaacaggtggtagagaaggtggagactgagtatgccaggctggagaacgggcgctttgtgtaccgtatccaccgctcgcccatgtgcgagtacatgatcaacttcatccacaagctgaagcacctgcccgagaagtacatgatgaacagcgtgctggagaacttcaccatcctgcaggtggtcacgagccgggactcccaggagaccctgcttgtcattgcttttgtcttcgaagtctccaccagtgagcacggggcccagcaccatgtctacaagctcgtcaaagactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - decapping enzyme, scavenger
- phytanoyl-CoA 2-hydroxylase
- RNA binding motif protein 9
- poly(rC) binding protein 4

Buy TEAD3-TEA domain family member 3 Gene now

Add to cart