Login to display prices
Login to display prices
TEAD3-TEA domain family member 3 Gene View larger

TEAD3-TEA domain family member 3 Gene

PTXBC027877

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TEAD3-TEA domain family member 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TEAD3-TEA domain family member 3 Gene

Proteogenix catalog: PTXBC027877
Ncbi symbol: TEAD3
Product name: TEAD3-TEA domain family member 3 Gene
Size: 2ug
Accessions: BC027877
Gene id: 7005
Gene description: TEA domain family member 3
Synonyms: DTEF-1; ETFR-1; TEAD-3; TEAD5; TEF-5; TEF5; transcriptional enhancer factor TEF-5; TEA domain family member 3; TEA domain family member 5; transcriptional enhancer factor 5; transcriptional enhancer factor TEF-5 (DTEF-1); TEA domain transcription factor 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacctggaccaggtctccaaggacaaagcccttcagagcatggcgtccatgtcctctgcccagatcgtctctgccagtgtcctgcagaacaagttcagcccaccttcccctctgccccaggccgtcttctccacttcctcgcggttctggagcagcccccctctcctgggacagcagcctggaccctctcaggacatcaagccctttgcacagccagcctaccccatccagccgcccctgccgccgacgctcagcagttatgagcccctggccccgctcccctcagctgctgcctctgtgcctgtgtggcaggaccgtaccattgcctcctcccggctgcggctcctggagtattcagccttcatggaggtgcagcgagaccctgacacgtacagcaaacacctgtttgtgcacatcggccagacgaaccccgccttctcagacccacccctggaggcagtagatgtgcgccagatctatgacaaattccccgagaaaaagggaggattgaaggagctctatgagaaggggccccctaatgccttcttccttgtcaagttctgggccgacctcaacagcaccatccaggagggcccgggagccttctatggggtcagctctcagtacagctctgctgatagcatgaccatcagcgtctccaccaaggtgtgctcctttggcaaacaggtggtagagaaggtggagactgagtatgccaggctggagaacgggcgctttgtgtaccgtatccaccgctcgcccatgtgcgagtacatgatcaacttcatccacaagctgaagcacctgcccgagaagtacatgatgaacagcgtgctggagaacttcaccatcctgcaggtggtcacgagccgggactcccaggagaccctgcttgtcattgcttttgtcttcgaagtctccaccagtgagcacggggcccagcaccatgtctacaagctcgtcaaagactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: