Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of DCPS-decapping enzyme, scavenger Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DCPS-decapping enzyme, scavenger Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014532 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DCPS |
| Origin species: | Human |
| Product name: | DCPS-decapping enzyme, scavenger Gene |
| Size: | 2ug |
| Accessions: | BC014532 |
| Gene id: | 28960 |
| Gene description: | decapping enzyme, scavenger |
| Synonyms: | scavenger mRNA-decapping enzyme DcpS; ARS; DCS1; HINT-5; HINT5; HSL1; HSPC015; m7GpppX diphosphatase; 5'-(N(7)-methyl 5'-triphosphoguanosine)-[mRNA] diphosphatase; decapping scavenger enzyme; heat shock-like protein 1; hint-related 7meGMP-directed hydrolase; histidine triad nucleotide-binding protein 5; histidine triad protein member 5; homolog of C. elegans 7meGMP-directed hydrolase dcs-1; mRNA decapping enzyme; decapping enzyme, scavenger |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggacgcagctcctcaactaggcaagaggaagcgcgaattggacgtggaggaggcccacgccgccagcacagaggaaaaggaggcaggagttggaaatggtacctgtgctcctgtccgcttaccgttctccggcttcagactgcagaaggtgctgagggagtctgcgcgggacaaaatcattttcctacacgggaaggtgaatgaggcctctgaggatggggatggagaggatgccgttgtgatcctggagaagacgccatttcaggtggaacaggtggctcagctcctgacgggcagccctgagctccaattgcagttctccaatgatatctacagcacctatcacttgttccctccaagacaactgaatgatgtaaagacgaccgtggtttaccctgccacagagaaacacctgcagaagtacctgcgccaggacctccgcctgatccgagagacgggagatgactacaggaacattactttaccccacctggagtcccagagcctcagcatccagtgggtgtataacattctcgacaagaaggctgaagcggaccggattgttttcgagaacccagatccctctgatggttttgtcctcatccctgacctcaagtggaaccaacagcagctcgatgacttgtacttgatcgccatctgccatcgccggggcatcagatccctacgcgaccttactccggagcacttgccgctgctcaggaacatcctccaccaggggcaggaggccatcctgcagcgctaccggatgaagggagaccatctgcgagtatacctgcactacctgccctcctactaccacctgcatgtgcacttcaccgccctgggcttcgaggcccccggctcaggcgtggagcgggcccacctgctggctgaggtgatcgagaacttggagtgtgaccctaggcactaccagcagcgcacgctcaccttcgccctcagggctgacgaccccctgctcaagctcttgcaggaggctcagcaaagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phytanoyl-CoA 2-hydroxylase - RNA binding motif protein 9 - poly(rC) binding protein 4 - poly(rC) binding protein 2 |