DCPS-decapping enzyme, scavenger Gene View larger

DCPS-decapping enzyme, scavenger Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DCPS-decapping enzyme, scavenger Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DCPS-decapping enzyme, scavenger Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014532
Product type: DNA & cDNA
Ncbi symbol: DCPS
Origin species: Human
Product name: DCPS-decapping enzyme, scavenger Gene
Size: 2ug
Accessions: BC014532
Gene id: 28960
Gene description: decapping enzyme, scavenger
Synonyms: scavenger mRNA-decapping enzyme DcpS; ARS; DCS1; HINT-5; HINT5; HSL1; HSPC015; m7GpppX diphosphatase; 5'-(N(7)-methyl 5'-triphosphoguanosine)-[mRNA] diphosphatase; decapping scavenger enzyme; heat shock-like protein 1; hint-related 7meGMP-directed hydrolase; histidine triad nucleotide-binding protein 5; histidine triad protein member 5; homolog of C. elegans 7meGMP-directed hydrolase dcs-1; mRNA decapping enzyme; decapping enzyme, scavenger
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggacgcagctcctcaactaggcaagaggaagcgcgaattggacgtggaggaggcccacgccgccagcacagaggaaaaggaggcaggagttggaaatggtacctgtgctcctgtccgcttaccgttctccggcttcagactgcagaaggtgctgagggagtctgcgcgggacaaaatcattttcctacacgggaaggtgaatgaggcctctgaggatggggatggagaggatgccgttgtgatcctggagaagacgccatttcaggtggaacaggtggctcagctcctgacgggcagccctgagctccaattgcagttctccaatgatatctacagcacctatcacttgttccctccaagacaactgaatgatgtaaagacgaccgtggtttaccctgccacagagaaacacctgcagaagtacctgcgccaggacctccgcctgatccgagagacgggagatgactacaggaacattactttaccccacctggagtcccagagcctcagcatccagtgggtgtataacattctcgacaagaaggctgaagcggaccggattgttttcgagaacccagatccctctgatggttttgtcctcatccctgacctcaagtggaaccaacagcagctcgatgacttgtacttgatcgccatctgccatcgccggggcatcagatccctacgcgaccttactccggagcacttgccgctgctcaggaacatcctccaccaggggcaggaggccatcctgcagcgctaccggatgaagggagaccatctgcgagtatacctgcactacctgccctcctactaccacctgcatgtgcacttcaccgccctgggcttcgaggcccccggctcaggcgtggagcgggcccacctgctggctgaggtgatcgagaacttggagtgtgaccctaggcactaccagcagcgcacgctcaccttcgccctcagggctgacgaccccctgctcaagctcttgcaggaggctcagcaaagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phytanoyl-CoA 2-hydroxylase
- RNA binding motif protein 9
- poly(rC) binding protein 4
- poly(rC) binding protein 2

Buy DCPS-decapping enzyme, scavenger Gene now

Add to cart