NTAN1-N-terminal asparagine amidase Gene View larger

NTAN1-N-terminal asparagine amidase Gene

PTXBC017336

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NTAN1-N-terminal asparagine amidase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NTAN1-N-terminal asparagine amidase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017336
Product type: DNA & cDNA
Ncbi symbol: NTAN1
Origin species: Human
Product name: NTAN1-N-terminal asparagine amidase Gene
Size: 2ug
Accessions: BC017336
Gene id: 123803
Gene description: N-terminal asparagine amidase
Synonyms: PNAA; PNAD; protein N-terminal asparagine amidohydrolase; protein N-terminal Asn amidase; protein N-terminal asparagine amidase; protein NH2-terminal asparagine deamidase; protein NTN-amidase; N-terminal asparagine amidase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgctgctcgtcgaggggcggcgagtgcggctgccgcagtcagccggggacctcgtccgagcccacccgcctttggaggaaagagccagacttctcagaggtcagtctgttcaacaagtgggaccccagggccttctgtatgttcagcaaagagagcttgcagtgacctccccaaaggatggctccatctccattctgggttctgatgatgccactacttgtcacattgtggtcctgaggcacacaggtaatggggccacctgcttgacacattgtgacggaaccgacaccaaagctgaggtccccttgatcatgaactccataaaatccttttctgaccacgctcaatgtggaaggctggaagtacaccttgttggaggcttcagtgacgacaggcagttgtcacaaaaactcactcatcaacttcttagtgaatttgacaggcaagaagatgacattcacttagtgacattatgtgtgacagaattaaatgaccgggaagaaaacgaaaaccactttccagtaatatatggcattgctgtcaacattaagactgcagagatttacagagcatcctttcaagatcggggtccggaggagcagcttcgtgctgcgcgaactttagcaggaggaccaatgattagcatttatgatgcagagacagaacaacttcgtataggaccgtactcctggacaccatttccacatgtggatttctggttgcaccaagatgacaagcaaatactagagaatctttccacttcgcctctggctgagccaccccactttgttgaacatattagatctaccttgatgtttttaaaaaaacacccatctccagctcacacactgttttctggaaataaagccctactctacaaaaaaaatgaagatggcttgtgggaaaagatctcttctccaggaagttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - melanoma antigen family A, 8
- atonal homolog 7 (Drosophila)
- complement factor H-related 1
- ribonuclease H2, subunit B

Buy NTAN1-N-terminal asparagine amidase Gene now

Add to cart