CFHR1-complement factor H-related 1 Gene View larger

CFHR1-complement factor H-related 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CFHR1-complement factor H-related 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CFHR1-complement factor H-related 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016755
Product type: DNA & cDNA
Ncbi symbol: CFHR1
Origin species: Human
Product name: CFHR1-complement factor H-related 1 Gene
Size: 2ug
Accessions: BC016755
Gene id: 3078
Gene description: complement factor H-related 1
Synonyms: CFHL; CFHL1; CFHL1P; CFHR1P; FHR1; H36-1; H36-2; HFL1; HFL2; complement factor H-related protein 1; FHR-1; H factor (complement)-like 1; H factor (complement)-like 2; H-factor-like 1; H36; complement factor H-related 1 pseudogene; h factor-like protein 1; complement factor H related 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggctcctggtcagtgtaattctaatctcacggatatcctctgttgggggagaagcaacattttgtgattttccaaaaataaaccatggaattctatatgatgaagaaaaatataagccattttcccaggttcctacaggggaagttttctattactcctgtgaatataattttgtgtctccttcaaaatcattttggactcgcataacatgcacagaagaaggatggtcaccaacaccaaagtgtctcagactgtgtttctttccttttgtggaaaatggtcattctgaatcttcaggacaaacacatctggaaggtgatactgtgcaaattatttgcaacacaggatacagacttcaaaacaatgagaacaacatttcatgtgtagaacggggctggtccacccctcccaaatgcaggtccactgacacttcctgtgtgaatccgcccacagtacaaaatgctcatatactgtcgagacagatgagtaaatatccatctggtgagagagtacgttatgaatgtaggagcccttatgaaatgtttggggatgaagaagtgatgtgtttaaatggaaactggacagaaccacctcaatgcaaagattctacgggaaaatgtgggccccctccacctattgacaatggggacattacttcattcccgttgtcagtatatgctccagcttcatcagttgagtaccaatgccagaacttgtatcaacttgagggtaacaagcgaataacatgtagaaatggacaatggtcagaaccaccaaaatgcttacatccgtgtgtaatatcccgagaaattatggaaaattataacatagcattaaggtggacagccaaacagaagctttatttgagaacaggtgaatcagctgaatttgtgtgtaaacggggatatcgtctttcatcacgttctcacacattgcgaacaacatgttgggatgggaaactggagtatccaacttgtgcaaaaagatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribonuclease H2, subunit B
- GTPase, IMAP family member 2
- G protein-coupled receptor 17
- homer homolog 2 (Drosophila)

Buy CFHR1-complement factor H-related 1 Gene now

Add to cart