Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ATOH7-atonal homolog 7 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATOH7-atonal homolog 7 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032621 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATOH7 |
| Origin species: | Human |
| Product name: | ATOH7-atonal homolog 7 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC032621 |
| Gene id: | 220202 |
| Gene description: | atonal homolog 7 (Drosophila) |
| Synonyms: | Math5; NCRNA; PHPVAR; RNANC; bHLHa13; protein atonal homolog 7; atonal homolog 7; atonal homolog bHLH transcription factor 7; class A basic helix-loop-helix protein 13; helix-loop-helix protein hATH-5; atonal bHLH transcription factor 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagtcctgcaagcccagcggcccgccggcgggagcgcgcgttgcacccccgtgcgcgggcggcaccgagtgcgcgggcacgtgcgccggggccgggcggctggagagcgcggcgcgcaggcgcctggcggccaacgcgcgcgagcgccgccgcatgcaggggctcaacactgccttcgaccgcttacgcagggtggttccccagtggggccaggataaaaagctgtccaagtacgagaccctgcagatggccctgagctacatcatggctctgacccggatcctggccgaggccgagcgattcggctcggagcgggactgggtgggtctccactgtgagcacttcggccgcgaccactacctcccgttcccgggcgcgaagctgccgggcgagagcgagctgtacagccagagactcttcggcttccagcccgagcccttccagatggccacctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - complement factor H-related 1 - ribonuclease H2, subunit B - GTPase, IMAP family member 2 - G protein-coupled receptor 17 |