ATOH7-atonal homolog 7 (Drosophila) Gene View larger

ATOH7-atonal homolog 7 (Drosophila) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATOH7-atonal homolog 7 (Drosophila) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ATOH7-atonal homolog 7 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032621
Product type: DNA & cDNA
Ncbi symbol: ATOH7
Origin species: Human
Product name: ATOH7-atonal homolog 7 (Drosophila) Gene
Size: 2ug
Accessions: BC032621
Gene id: 220202
Gene description: atonal homolog 7 (Drosophila)
Synonyms: Math5; NCRNA; PHPVAR; RNANC; bHLHa13; protein atonal homolog 7; atonal homolog 7; atonal homolog bHLH transcription factor 7; class A basic helix-loop-helix protein 13; helix-loop-helix protein hATH-5; atonal bHLH transcription factor 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagtcctgcaagcccagcggcccgccggcgggagcgcgcgttgcacccccgtgcgcgggcggcaccgagtgcgcgggcacgtgcgccggggccgggcggctggagagcgcggcgcgcaggcgcctggcggccaacgcgcgcgagcgccgccgcatgcaggggctcaacactgccttcgaccgcttacgcagggtggttccccagtggggccaggataaaaagctgtccaagtacgagaccctgcagatggccctgagctacatcatggctctgacccggatcctggccgaggccgagcgattcggctcggagcgggactgggtgggtctccactgtgagcacttcggccgcgaccactacctcccgttcccgggcgcgaagctgccgggcgagagcgagctgtacagccagagactcttcggcttccagcccgagcccttccagatggccacctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - complement factor H-related 1
- ribonuclease H2, subunit B
- GTPase, IMAP family member 2
- G protein-coupled receptor 17

Buy ATOH7-atonal homolog 7 (Drosophila) Gene now

Add to cart