MAGEA8-melanoma antigen family A, 8 Gene View larger

MAGEA8-melanoma antigen family A, 8 Gene

PTXBC002455

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAGEA8-melanoma antigen family A, 8 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAGEA8-melanoma antigen family A, 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002455
Product type: DNA & cDNA
Ncbi symbol: MAGEA8
Origin species: Human
Product name: MAGEA8-melanoma antigen family A, 8 Gene
Size: 2ug
Accessions: BC002455
Gene id: 4107
Gene description: melanoma antigen family A, 8
Synonyms: CT1.8; MAGE8; melanoma-associated antigen 8; MAGE-8 antigen; cancer/testis antigen 1.8; cancer/testis antigen family 1, member 8; melanoma antigen family A, 8; melanoma antigen family A8; MAGE family member A8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcttcttgggcagaagagtcagcgctacaaggctgaggaaggccttcaggcccaaggagaggcaccagggcttatggatgtgcagattcccacagctgaggagcagaaggctgcatcctcctcctctactctgatcatgggaacccttgaggaggtgactgattctgggtcaccaagtcctccccagagtcctgagggtgcctcctcttccctgactgtcaccgacagcactctgtggagccaatccgatgagggttccagcagcaatgaagaggaggggccaagcacctccccggacccagctcacctggagtccctgttccgggaagcacttgatgagaaagtggctgagttagttcgtttcctgctccgcaaatatcaaattaaggagccggtcacaaaggcagaaatgcttgagagtgtcatcaaaaattacaagaaccactttcctgatatcttcagcaaagcctctgagtgcatgcaggtgatctttggcattgatgtgaaggaagtggaccctgccggccactcctacatccttgtcacctgcctgggcctctcctatgatggcctgctgggtgatgatcagagtacgcccaagaccggcctcctgataatcgtcctgggcatgatcttaatggagggcagccgcgccccggaggaggcaatctgggaagcgttgagtgtgatggggctgtatgatgggagggagcacagtgtctattggaagctcaggaagctgctcacccaagagtgggtgcaggagaactacctggagtaccgccaggcgcccggcagtgatcctgtgcgctacgagttcctgtggggtccaagggcccttgctgaaaccagctatgtgaaagtcctggagcatgtggtcagggtcaatgcaagagttcgcatttcctacccatccctgcatgaagaggctttgggagaggagaaaggagtttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - atonal homolog 7 (Drosophila)
- complement factor H-related 1
- ribonuclease H2, subunit B
- GTPase, IMAP family member 2

Buy MAGEA8-melanoma antigen family A, 8 Gene now

Add to cart