Login to display prices
Login to display prices
UNKL-unkempt homolog (Drosophila)-like Gene View larger

UNKL-unkempt homolog (Drosophila)-like Gene

PTXBC011924

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UNKL-unkempt homolog (Drosophila)-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UNKL-unkempt homolog (Drosophila)-like Gene

Proteogenix catalog: PTXBC011924
Ncbi symbol: UNKL
Product name: UNKL-unkempt homolog (Drosophila)-like Gene
Size: 2ug
Accessions: BC011924
Gene id: 64718
Gene description: unkempt homolog (Drosophila)-like
Synonyms: C16orf28; ZC3H5L; ZC3HDC5L; RING finger protein unkempt-like; unkempt family zinc finger-like; unkempt homolog-like; zinc finger CCCH domain-containing protein 5-like; unkempt family like zinc finger
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgtcggtctcgaaagcggcggcagcggcgctgagcgggtcccccccgcagacggagaagccgacccactacaggtacctgaaggagttcaggacggagcagtgccccctgttttcacagcacaagtgcgcgcagcaccggccgttcacctgcttccactggcacttcctcaaccagcggcgccgcaggcccctccgcaggcgcgacggcaccttcaactacagccccgacgtgtactgctccaagtacaacgaagccaccggcgtgtgccccgacggcgacgagtgtccctacctgcaccggacgacgggggacacagaacgcaagtaccacctgcgttactacaaaacaggaacctgcatccacgagacagacgcacgtggccactgcgtgaagaatgggctgcactgtgccttcgcgcacggccccctggacctgcggccgcccgtgtgtgacgtcagggagctgcaggcccaggaagccttgcagaacggccagctgggcggcggggaaggggtcccggatctgcagcctggggtcttggccagccaggccatgattgagaagatcctgagcgaggacccccggtggcaagatgccaacttcgtgctgggcagctacaagacggagcagtgcccgaagccgccacgcctgtgccgccagggctatgcgtgcccacactaccacaatagccgggacaggcggcgcaacccccggcggttccagtacagctggcagctgggacgccgggtccttaggctgagtcccagggccaacaacccaagggtcgccctgcccagggtgcacacaggaccttcctccaccgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: