CDCA3-cell division cycle associated 3 Gene View larger

CDCA3-cell division cycle associated 3 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDCA3-cell division cycle associated 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CDCA3-cell division cycle associated 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002551
Product type: DNA & cDNA
Ncbi symbol: CDCA3
Origin species: Human
Product name: CDCA3-cell division cycle associated 3 Gene
Size: 2ug
Accessions: BC002551
Gene id: 83461
Gene description: cell division cycle associated 3
Synonyms: GRCC8; TOME-1; cell division cycle-associated protein 3; gene-rich cluster protein C8; trigger of mitotic entry protein 1; cell division cycle associated 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctcagccaagagcgtcccagtcacaccagcgcggcctccgccgcacaacaagcatctggctcgagtggcggacccccgttcacctagtgctggcatcctgcgcactcccatccaggtggagagctctccacagccaggcctaccagcaggggagcaactggagggtcttaaacatgcccaggactcagatccccgctctcctactcttggtattgcacggacacctatgaagaccagcagtggagaccccccaagcccactggtgaaacagctgagtgaagtatttgaaactgaagactctaaatcaaatcttcccccagagcctgttctgcccccagaggcacctttatcttctgaattggacttgcctctgggtacccagttatctgttgaggaacagatgccaccttggaaccagactgagttcccctccaaacaggtgttttccaaggaggaagcaagacagcccacagaaacccctgtggccagccagagctccgacaagccctcaagggaccctgagactcccagatcttcaggttctatgcgcaatagatggaaaccaaacagcagcaaggtactagggagatcccccctcaccatcctgcaggatgacaactcccctggcaccctgacactacgacagggtaagcggccttcacccctaagtgaaaatgttagtgaactaaaggaaggagccattcttggaactggacgacttctgaaaactggaggacgagcatgggagcaaggccaggaccatgacaaggaaaatcagcactttcccttggtggagagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - collectin sub-family member 11
- hypothetical protein MGC40574
- unkempt homolog (Drosophila)-like
- cell division cycle associated 8

Buy CDCA3-cell division cycle associated 3 Gene now

Add to cart