Login to display prices
Login to display prices
COLEC11-collectin sub-family member 11 Gene View larger

COLEC11-collectin sub-family member 11 Gene

PTXBC000078

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COLEC11-collectin sub-family member 11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about COLEC11-collectin sub-family member 11 Gene

Proteogenix catalog: PTXBC000078
Ncbi symbol: COLEC11
Product name: COLEC11-collectin sub-family member 11 Gene
Size: 2ug
Accessions: BC000078
Gene id: 78989
Gene description: collectin sub-family member 11
Synonyms: 3MC2; CL-K1-I; CL-K1-II; CL-K1-IIa; CL-K1-IIb; CLK1; collectin-11; Collectin K1; collectin kidney protein 1; collectin sub-family member 11; collectin subfamily member 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagggggaatctggccctggtgggcgttctaatcagcctggccttcctgtcactgctgccatctggacatcctcagccggctggcgatgacgcctgctctgtgcagatcctcgtccctggcctcaaaggggatgcgggagagaagggagacaaaggcgcccccggacggcctggaagagtcggccccacgggagaaaaaggagacatgggggacaaaggacagaaaggcagtgtgggtcgtcatggaaaaattggtcccattggctctaaaggtgagaaaggagattccggtgacataggaccccctggtcctaatggagaaccaggcctcccatgtgagtgcagccagctgcgcaaggccatcggggagatggacaaccaggtctctcagctgaccagcgagctcaagttcatcaagaatgctgtcgccggtgtgcgcgagacggagagcaagatctacctgctggtgaaggaggagaagcgctacgcggacgcccagctgtcctgccagggccgcgggggcacgctgagcatgcccaaggacgaggctgccaatggcctgatggccgcatacctggcgcaagccggcctggcccgtgtcttcatcggcatcaacgacctggagaaggagggcgccttcgtgtactctgaccactcccccatgcggaccttcaacaagtggcgcagcggtgagcccaacaatgcctacgacgaggaggactgcgtggagatggtggcctcgggcggctggaacgacgtggcctgccacaccaccatgtacttcatgtgtgagtttgacaaggagaacatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: