Login to display prices
Login to display prices
PENK-proenkephalin Gene View larger

PENK-proenkephalin Gene

PTXBC032505

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PENK-proenkephalin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PENK-proenkephalin Gene

Proteogenix catalog: PTXBC032505
Ncbi symbol: PENK
Product name: PENK-proenkephalin Gene
Size: 2ug
Accessions: BC032505
Gene id: 5179
Gene description: proenkephalin
Synonyms: PENK-A; proenkephalin-A; enkephalin A; peptide F; preproenkephalin; proenkephalin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcggttcctgacactttgcacttggctgctgttgctcggccccgggctcctggcgaccgtgcgggccgaatgcagccaggattgcgcgacgtgcagctaccgcctagtgcgcccggccgacatcaacttcctggcttgcgtaatggaatgtgaaggtaaactgccttctctgaaaatttgggaaacctgcaaggagctcctgcagctgtccaaaccagagcttcctcaagatggcaccagcaccctcagagaaaatagcaaaccggaagaaagccatttgctagccaaaaggtatgggggcttcatgaaaaggtatggaggcttcatgaagaaaatggatgagctttatcccatggagccagaagaagaggccaatggaagtgagatcctcgccaagcggtatgggggcttcatgaagaaggatgcagaggaggacgactcgctggccaattcctcagacctgctaaaagagcttctggaaacaggggacaaccgagagcgtagccaccaccaggatggcagtgataatgaggaagaagtgagcaagagatatgggggcttcatgagaggcttaaagagaagcccccaactggaagatgaagccaaagagctgcagaagcgatatgggggcttcatgagaagagtaggtcgcccagagtggtggatggactaccagaaacggtatggaggtttcctgaagcgctttgccgaggctctgccctccgacgaagaaggcgaaagttactccaaagaagttcctgaaatggaaaaaagatacggaggatttatgagattttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: