Login to display prices
Login to display prices
CTSL1-cathepsin L1 Gene View larger

CTSL1-cathepsin L1 Gene

PTXBC012612

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CTSL1-cathepsin L1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CTSL1-cathepsin L1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012612
Product type: DNA & cDNA
Ncbi symbol: CTSL1
Origin species: Human
Product name: CTSL1-cathepsin L1 Gene
Size: 2ug
Accessions: BC012612
Gene id: 1514
Gene description: cathepsin L1
Synonyms: CTSL1; CATL; MEP; cathepsin L1; major excreted protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatcctacactcatccttgctgccttttgcctgggaattgcctcagctactctaacatttgatcacagtttagaggcacagtggaccaagtggaaggcgatgcacaacagattatacggcatgaatgaagaaggatggaggagagcagtgtgggagaagaacgtgaagatgattgaactgcacaatcaggaatacagggaagggaaacacagcttcacaatggccatgaacgcctttggagacatgaccagtgaagaattcaggcaggtgatgaatggctttcaaaaccgtaagcccaggaaggggaaagtgttccaggaacctctgttttatgaggcccccagatctgtggattggagagagaaaggctacgtgactcctgtgaagaatcagggtcagtgtggttcttgttgggcttttagtgctactggtgctcttgaaggacagatgttccggaaaactgggaggcttatctcactgagtgagcagaatctggtagactgctctgggcctcaaggcaatgaaggctgcaatggtggcctaatggattatgctttccagtatgttcaggataatggaggcctggactctgaggaatcctatccatatgaggcaacagaagaatcctgtaagtacaatcccaagtattctgttgctaatgacaccggctttgtggacatccctaagcaggagaaggccctgatgaaggcagttgcaactgtggggcccatttctgttgctattgatgcaggtcatgagtccttcctgttctataaagaaggcatttattttgagccagactgtagcagtgaagacatggatcatggtgtgctggtggttggctacggatttgaaagcacagaatcagataacaataaatattggctggtgaagaacagctggggtgaagaatggggcatgggtggctacgtaaagatggccaaagaccggagaaaccattgtggaattgcctcagcagccagctaccccactgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CD48 molecule
- CD33 molecule
- paralemmin 2
- annexin A11