Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CD48-CD48 molecule Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CD48-CD48 molecule Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030224 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CD48 |
| Origin species: | Human |
| Product name: | CD48-CD48 molecule Gene |
| Size: | 2ug |
| Accessions: | BC030224 |
| Gene id: | 962 |
| Gene description: | CD48 molecule |
| Synonyms: | CD48 molecule; CD48 antigen (B-cell membrane protein); CD48 antigen; BCM1; BLAST; BLAST1; MEM-102; SLAMF2; hCD48; mCD48; B-lymphocyte activation marker BLAST-1; BCM1 surface antigen; SLAM family member 2; TCT.1; leukocyte antigen MEM-102; signaling lymphocytic activation molecule 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgctccagaggttgggattcgtgtctggctctggaattgctactgctgcctctgtcactcctggtgaccagcattcaaggtcacttggtacatatgaccgtggtctccggcagcaacgtgactctgaacatctctgagagcctgcctgagaactacaaacaactaacctggttttatactttcgaccagaagattgtagaatgggattccagaaaatctaagtactttgaatccaaatttaaaggcagggtcagacttgatcctcagagtggcgcactgtacatctctaaggtccagaaagaggacaacagcacctacatcatgagggtgttgaaaaagactgggaatgagcaagaatggaagatcaagctgcaagtgcttggtgagtcaggggagccaaagagcaaatccccactccagtggccccagatggaccactgtagggcttcctgggaggcatggggcactctcggggaggaggagagaaaaacctcaggacaggtttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CD33 molecule - paralemmin 2 - annexin A11 - TSPY-like 4 |