Login to display prices
Login to display prices
CD86-CD86 molecule Gene View larger

CD86-CD86 molecule Gene

PTXBC040261

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CD86-CD86 molecule Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CD86-CD86 molecule Gene

Proteogenix catalog: PTXBC040261
Ncbi symbol: CD86
Product name: CD86-CD86 molecule Gene
Size: 2ug
Accessions: BC040261
Gene id: 942
Gene description: CD86 molecule
Synonyms: CD86 molecule; CD86 antigen (CD28 antigen ligand 2, B7-2 antigen); T-lymphocyte activation antigen CD86; B7-2; B7.2; B70; CD28LG2; LAB72; B-lymphocyte activation antigen B7-2; BU63; CTLA-4 counter-receptor B7.2; FUN-1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatccccagtgcactatgggactgagtaacattctctttgtgatggccttcctgctctctggtgctgctcctctgaagattcaagcttatttcaatgagactgcagacctgccatgccaatttgcaaactctcaaaaccaaagcctgagtgagctagtagtattttggcaggaccaggaaaacttggttctgaatgaggtatacttaggcaaagagaaatttgacagtgttcattccaagtatatgggccgcacaagttttgattcggacagttggaccctgagacttcacaatcttcagatcaaggacaagggcttgtatcaatgtatcatccatcacaaaaagcccacaggaatgattcgcatccaccagatgaattctgaactgtcagtgcttgctaacttcagtcaacctgaaatagtaccaatttctaatataacagaaaatgtgtacataaatttgacctgctcatctatacacggttacccagaacctaagaagatgagtgttttgctaagaaccaagaattcaactatcgagtatgatggtattatgcagaaatctcaagataatgtcacagaactgtacgacgtttccatcagcttgtctgtttcattccctgatgttacgagcaatatgaccatcttctgtattctggaaactgacaagacgcggcttttatcttcacctttctctatagagcttgaggaccctcagcctcccccagaccacattccttggattacagctgtacttccaacagttattatatgtgtgatggttttctgtctaattctatggaaatggaagaagaagaagcggcctcgcaactcttataaatgtggaaccaacacaatggagagggaagagagtgaacagaccaagaaaagagaaaaaatccatatacctgaaagatctgatgaaacccagcgtgtttttaaaagttcgaagacatcttcatgcgacaaaagtgatacatgtttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: