CDCA4-cell division cycle associated 4 Gene View larger

CDCA4-cell division cycle associated 4 Gene

PTXBC011736

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDCA4-cell division cycle associated 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CDCA4-cell division cycle associated 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011736
Product type: DNA & cDNA
Ncbi symbol: CDCA4
Origin species: Human
Product name: CDCA4-cell division cycle associated 4 Gene
Size: 2ug
Accessions: BC011736
Gene id: 55038
Gene description: cell division cycle associated 4
Synonyms: HEPP; SEI-3/HEPP; cell division cycle-associated protein 4; hematopoietic progenitor protein; cell division cycle associated 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttgcacgaggactgaagaggaaatgtgttggccacgaggaagacgtggagggagccctggccggcttgaagacagtgtcctcatacagcctgcagcggcagtcgctcctggacatgtctctggtgaagttgcagctttgccacatgcttgtggagcccaatctgtgccgctcagtcctcattgccaacacggtccggcagatccaagaggagatgacgcaggatgggacgtggcgcacagtggcaccccaggctgcagagcgggcgccgctcgaccgcttggtctccacggagatcctgtgccgtgcagcgtgggggcaagagggggcacatcctgctcctggcttgggggacggccacacacagggtccagtttctgacctttgcccagtcacctcagcacaggcaccaaggcacctgcagagcagcgcctgggagatggatggccctcgagaaaacagaggaagctttcacaagtcacttgatcagatatttgaaacgctggagactaaaaaccccagctgcatggaagagctgttctcagacgtggacagcccctactacgacctggacacagtactgacaggcatgatggggggtgccaggccgggcccctgcgaagggctcgagggcttggctccggccaccccaggccctagctccagctgcaagtccgacctgggcgagctggaccacgtggtggagatcctggtggagacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cell division cycle associated 3
- collectin sub-family member 11
- hypothetical protein MGC40574
- unkempt homolog (Drosophila)-like

Buy CDCA4-cell division cycle associated 4 Gene now

Add to cart