KDELR3-KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 Gene View larger

KDELR3-KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 Gene

PTXBC001277

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KDELR3-KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KDELR3-KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001277
Product type: DNA & cDNA
Ncbi symbol: KDELR3
Origin species: Human
Product name: KDELR3-KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 Gene
Size: 2ug
Accessions: BC001277
Gene id: 11015
Gene description: KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
Synonyms: ERD2L3; ER lumen protein-retaining receptor 3; KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3; KDEL receptor 3; KDEL endoplasmic reticulum protein retention receptor 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacgtgttccgaatcctcggcgacctgagccacctcctggccatgatcttgctgctggggaagatctggaggtccaagtgctgcaagggcatctctgggaagagccagatcctgtttgctctcgtcttcaccaccaggtacctggacctgttcaccaacttcatctccatctacaacacagtaatgaaggtggtttttctcctctgtgcctatgttacagtgtacatgatatatgggaaattccgtaaaacttttgacagtgagaatgacacattccgcctggagtttcttctggtcccagtcattggcctttccttccttgaaaactacagtttcactctgctggagatcctctggactttctctatctatctggaatcagtggctatcctgccccagctcttcatgatcagcaagactggagaggctgagaccataactactcactacctgttctttctgggtctgtaccgggcactctacctggctaactggatcaggcggtaccagactgagaatttctatgaccaaattgcagtcgtgtctggagtagtacaaaccatcttctactgtgacttcttctacttgtatgtgaccaaagtccttaagggaaagaagttaagtcttccaatgccaatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - myeloma overexpressed (in a subset of t(11;14) positive multiple myelomas)
- protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform
- transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)
- transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B)

Buy KDELR3-KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 Gene now

Add to cart