TCEB1-transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) Gene View larger

TCEB1-transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) Gene

PTXBC013809

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TCEB1-transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TCEB1-transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013809
Product type: DNA & cDNA
Ncbi symbol: TCEB1
Origin species: Human
Product name: TCEB1-transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) Gene
Size: 2ug
Accessions: BC013809
Gene id: 6921
Gene description: transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)
Synonyms: TCEB1; SIII; transcription elongation factor B polypeptide 1; RNA polymerase II transcription factor SIII subunit C; SIII p15; elongin 15 kDa subunit; transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C); transcription elongation factor B subunit 1; elongin C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatggagaggagaaaacctatggtggctgtgaaggacctgatgccatgtatgtcaaattgatatcatctgatggccatgaatttattgtaaaaagagaacatgcattaacatcaggcacgataaaagccatgttgagtggcccaggtcagtttgctgagaacgaaaccaatgaggtcaattttagagagataccttcacatgtgctatcgaaagtatgcatgtattttacgtacaaggttcgctacactaacagctccaccgagattcctgaattcccaattgcacctgaaattgcactggaactgctgatggctgcgaacttcttagattgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B)
- nudix (nucleoside diphosphate linked moiety X)-type motif 9 pseudogene 1
- protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)
- sterol-C5-desaturase (ERG3 delta-5-desaturase homolog, S. cerevisiae)-like

Buy TCEB1-transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) Gene now

Add to cart