Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TCEB1-transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) Gene
PTXBC013809
New product
Data sheet of TCEB1-transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TCEB1-transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013809 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TCEB1 |
| Origin species: | Human |
| Product name: | TCEB1-transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) Gene |
| Size: | 2ug |
| Accessions: | BC013809 |
| Gene id: | 6921 |
| Gene description: | transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) |
| Synonyms: | TCEB1; SIII; transcription elongation factor B polypeptide 1; RNA polymerase II transcription factor SIII subunit C; SIII p15; elongin 15 kDa subunit; transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C); transcription elongation factor B subunit 1; elongin C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatggagaggagaaaacctatggtggctgtgaaggacctgatgccatgtatgtcaaattgatatcatctgatggccatgaatttattgtaaaaagagaacatgcattaacatcaggcacgataaaagccatgttgagtggcccaggtcagtttgctgagaacgaaaccaatgaggtcaattttagagagataccttcacatgtgctatcgaaagtatgcatgtattttacgtacaaggttcgctacactaacagctccaccgagattcctgaattcccaattgcacctgaaattgcactggaactgctgatggctgcgaacttcttagattgttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) - nudix (nucleoside diphosphate linked moiety X)-type motif 9 pseudogene 1 - protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) - sterol-C5-desaturase (ERG3 delta-5-desaturase homolog, S. cerevisiae)-like |