Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PIN4-protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) Gene
PTXBC005234
New product
Data sheet of PIN4-protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PIN4-protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005234 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PIN4 |
| Origin species: | Human |
| Product name: | PIN4-protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) Gene |
| Size: | 2ug |
| Accessions: | BC005234 |
| Gene id: | 5303 |
| Gene description: | protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) |
| Synonyms: | rotamase PIN4; peptidyl-prolyl cis-trans isomerase Pin4; PPIase PIN4; EPVH; PAR14; PAR17; peptidyl-prolyl cis-trans isomerase NIMA-interacting 4; eukaryotic parvulin homolog; hEPVH; hPar14; hPar17; parvulin; parvulin-14; parvulin-17; peptidyl-prolyl cis/trans isomerase EPVH; protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin); peptidylprolyl cis/trans isomerase, NIMA-interacting 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgcccaaaggaaaaagtggttctggaaaagcggggaaagggggagcagcctctgggagtgacagtgctgacaagaaggctcaaggtcccaaaggtggtggcaatgcagtaaaggtcagacacattctatgtgaaaaacatggcaaaatcatggaagccatggaaaagttaaagtctgggatgagattcaatgaagtggccgcacagtatagtgaagataaagccaggcaagggggtgacttgggttggatgaccagagggtccatggtgggaccatttcaagaagcagcatttgccttgcctgtaagtgggatggataagcctgtgtttacagacccaccggttaagacaaaatttggatatcatattattatggtcgaaggaagaaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - sterol-C5-desaturase (ERG3 delta-5-desaturase homolog, S. cerevisiae)-like - aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase - guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 - guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 |