Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
AASDHPPT-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase Gene
PTXBC015470
New product
Data sheet of AASDHPPT-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AASDHPPT-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015470 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AASDHPPT |
| Origin species: | Human |
| Product name: | AASDHPPT-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase Gene |
| Size: | 2ug |
| Accessions: | BC015470 |
| Gene id: | 60496 |
| Gene description: | aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase |
| Synonyms: | AASD-PPT; ACPS; CGI-80; LYS2; L-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase; 4'-phosphopantetheinyl transferase; LYS5 ortholog; alpha-aminoadipic semialdehyde dehydrogenase-phosphopantetheinyl transferase; holo ACP synthase; holo-[acyl-carrier-protein] synthase; aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggttttccctgccaaacggttctgcttggtgccatccatggagggcgtgcgctgggccttttcctgcggcacttggctgccgagccgagccgaatggctgctggcagtgcgatcgattcagcccgaggagaaggagcgcattggccagttcgtctttgcccgggacgctaaggcagccatggctggtcgtctgatgataaggaaattagttgcagagaaactgaatatcccttggaatcatattcgtttgcaaagaactgcaaaaggaaaaccagttcttgcaaaggactcatcgaatccttacccgaatttcaactttaacatctctcatcaaggagactatgcagtgcttgctgctgaacctgagctgcaagttggaattgatataatgaagactagttttccaggtcgtggttcaattccagaattctttcatattatgaaaagaaagtttaccaacaaagaatgggaaacaatcagaagctttaaggatgagtggactcagctggatatgttttataggaattgggcacttaaggaaagcttcataaaagccattggtgttggactaggatttgaattgcagcggcttgaatttgatctatctccattaaacttggatataggccaagtttataaagaaacacgtttattcctggatggagaggaagaaaaagaatgggcatttgaggaaagcaaaatagatgagcaccattttgttgcagttgctcttaggaaacccgatggatctagacatcaggatgttccatctcaggatgattccaaaccaacccagaggcaatttactattctcaactttaatgatttaatgtcatctgccgttcccatgacacctgaagatccttcattttgggactgtttttgcttcacagaagaaattccaatacgaaatggtacaaagtcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 - guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 - protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform - hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing |