AASDHPPT-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase Gene View larger

AASDHPPT-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase Gene

PTXBC015470

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AASDHPPT-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AASDHPPT-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015470
Product type: DNA & cDNA
Ncbi symbol: AASDHPPT
Origin species: Human
Product name: AASDHPPT-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase Gene
Size: 2ug
Accessions: BC015470
Gene id: 60496
Gene description: aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Synonyms: AASD-PPT; ACPS; CGI-80; LYS2; L-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase; 4'-phosphopantetheinyl transferase; LYS5 ortholog; alpha-aminoadipic semialdehyde dehydrogenase-phosphopantetheinyl transferase; holo ACP synthase; holo-[acyl-carrier-protein] synthase; aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttttccctgccaaacggttctgcttggtgccatccatggagggcgtgcgctgggccttttcctgcggcacttggctgccgagccgagccgaatggctgctggcagtgcgatcgattcagcccgaggagaaggagcgcattggccagttcgtctttgcccgggacgctaaggcagccatggctggtcgtctgatgataaggaaattagttgcagagaaactgaatatcccttggaatcatattcgtttgcaaagaactgcaaaaggaaaaccagttcttgcaaaggactcatcgaatccttacccgaatttcaactttaacatctctcatcaaggagactatgcagtgcttgctgctgaacctgagctgcaagttggaattgatataatgaagactagttttccaggtcgtggttcaattccagaattctttcatattatgaaaagaaagtttaccaacaaagaatgggaaacaatcagaagctttaaggatgagtggactcagctggatatgttttataggaattgggcacttaaggaaagcttcataaaagccattggtgttggactaggatttgaattgcagcggcttgaatttgatctatctccattaaacttggatataggccaagtttataaagaaacacgtttattcctggatggagaggaagaaaaagaatgggcatttgaggaaagcaaaatagatgagcaccattttgttgcagttgctcttaggaaacccgatggatctagacatcaggatgttccatctcaggatgattccaaaccaacccagaggcaatttactattctcaactttaatgatttaatgtcatctgccgttcccatgacacctgaagatccttcattttgggactgtttttgcttcacagaagaaattccaatacgaaatggtacaaagtcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1
- guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1
- protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform
- hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing

Buy AASDHPPT-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase Gene now

Add to cart