Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PPP2R2C-protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform Gene
PTXBC032954
New product
Data sheet of PPP2R2C-protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPP2R2C-protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032954 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPP2R2C |
| Origin species: | Human |
| Product name: | PPP2R2C-protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform Gene |
| Size: | 2ug |
| Accessions: | BC032954 |
| Gene id: | 5522 |
| Gene description: | protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform |
| Synonyms: | B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G; protein phosphatase 2, regulatory subunit B, gamma; PP2A, subunit B, B-gamma isoform; PP2A, subunit B, B55-gamma isoform; PP2A, subunit B, PR55-gamma isoform; PP2A, subunit B, R2-gamma isoform; gamma isoform of regulatory subunit B55, protein phosphatase 2; phosphoprotein phosphatase 2A BR gamma regulatory chain; protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform; protein phosphatase 2A1 B gamma subunit; serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B gamma isoform; protein phosphatase 2 regulatory subunit Bgamma |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggaaagagagacacggctgacatcatctctaccgttgagttcaaccacacgggagagctgctggccacaggtgacaagggcggccgggtcgtcatcttccagcgggaaccagagagtaaaaatgcgccccacagccagggcgaatacgacgtgtacagcactttccagagccacgagccggagtttgactatctcaagagcctggagatagaggagaagatcaacaagatcaagtggctcccacagcagaacgccgcccactcactcctgtccaccaacgataaaactatcaaattatggaagattaccgaacgagataaaaggcccgaaggatacaacctgaaggatgaagaggggaaacttaaggacctgtccacggtgacgtcactgcaggtgccagtgctgaagcccatggatctgatggtggaggtgagccctcggaggatctttgccaatggccacacctaccacatcaactccatctccgtcaacagtgactgcgagacctacatgtcggcggatgacctgcgcatcaacctctggcacctggccatcaccgacaggagcttcaacatcgtggacatcaagccggccaacatggaggaccttacggaggtgatcacagcatctgagttccatccgcaccactgcaacctcttcgtctacagcagcagcaagggctccctgcggctctgcgacatgcgggcagctgccctgtgtgacaagcattccaagctctttgaagagcctgaggaccccagtaaccgctcattcttctcggaaatcatctcctccgtgtccgacgtgaagttcagccacagcggccgctacatgctcacccgggactaccttacagtcaaggtctgggacctgaacatggaggcaagacccatagagacctaccaggtccatgactaccttcggagcaagctctgttccctgtacgagaacgactgcattttcgacaagtttgaatgtgcctggaacgggagcgacagcgtcatcatgaccggggcctacaacaacttcttccgcatgttcgatcggaacaccaagcgggacgtgaccctggaggcctcgagggaaagcagcaagccccgggctgtgctcaagccacggcgcgtgtgcgtggggggcaagcgccggcgtgatgacatcagtgtggacagcttggacttcaccaagaagatcctgcacacggcctggcacccggctgagaacatcattgccattgccgccaccaacaacctgtacatcttccaggacaaggtaaactctgacatgcactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing - solute carrier family 6 (neurotransmitter transporter, taurine), member 6 - KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 - KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 |