Login to display prices
Login to display prices
PPP2R2C-protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform Gene View larger

PPP2R2C-protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform Gene

PTXBC032954

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPP2R2C-protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPP2R2C-protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform Gene

Proteogenix catalog: PTXBC032954
Ncbi symbol: PPP2R2C
Product name: PPP2R2C-protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform Gene
Size: 2ug
Accessions: BC032954
Gene id: 5522
Gene description: protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform
Synonyms: B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G; protein phosphatase 2, regulatory subunit B, gamma; PP2A, subunit B, B-gamma isoform; PP2A, subunit B, B55-gamma isoform; PP2A, subunit B, PR55-gamma isoform; PP2A, subunit B, R2-gamma isoform; gamma isoform of regulatory subunit B55, protein phosphatase 2; phosphoprotein phosphatase 2A BR gamma regulatory chain; protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform; protein phosphatase 2A1 B gamma subunit; serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B gamma isoform; protein phosphatase 2 regulatory subunit Bgamma
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaaagagagacacggctgacatcatctctaccgttgagttcaaccacacgggagagctgctggccacaggtgacaagggcggccgggtcgtcatcttccagcgggaaccagagagtaaaaatgcgccccacagccagggcgaatacgacgtgtacagcactttccagagccacgagccggagtttgactatctcaagagcctggagatagaggagaagatcaacaagatcaagtggctcccacagcagaacgccgcccactcactcctgtccaccaacgataaaactatcaaattatggaagattaccgaacgagataaaaggcccgaaggatacaacctgaaggatgaagaggggaaacttaaggacctgtccacggtgacgtcactgcaggtgccagtgctgaagcccatggatctgatggtggaggtgagccctcggaggatctttgccaatggccacacctaccacatcaactccatctccgtcaacagtgactgcgagacctacatgtcggcggatgacctgcgcatcaacctctggcacctggccatcaccgacaggagcttcaacatcgtggacatcaagccggccaacatggaggaccttacggaggtgatcacagcatctgagttccatccgcaccactgcaacctcttcgtctacagcagcagcaagggctccctgcggctctgcgacatgcgggcagctgccctgtgtgacaagcattccaagctctttgaagagcctgaggaccccagtaaccgctcattcttctcggaaatcatctcctccgtgtccgacgtgaagttcagccacagcggccgctacatgctcacccgggactaccttacagtcaaggtctgggacctgaacatggaggcaagacccatagagacctaccaggtccatgactaccttcggagcaagctctgttccctgtacgagaacgactgcattttcgacaagtttgaatgtgcctggaacgggagcgacagcgtcatcatgaccggggcctacaacaacttcttccgcatgttcgatcggaacaccaagcgggacgtgaccctggaggcctcgagggaaagcagcaagccccgggctgtgctcaagccacggcgcgtgtgcgtggggggcaagcgccggcgtgatgacatcagtgtggacagcttggacttcaccaagaagatcctgcacacggcctggcacccggctgagaacatcattgccattgccgccaccaacaacctgtacatcttccaggacaaggtaaactctgacatgcactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: