Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KDELR2-KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 Gene
PTXBC008081
New product
Data sheet of KDELR2-KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KDELR2-KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008081 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KDELR2 |
| Origin species: | Human |
| Product name: | KDELR2-KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 Gene |
| Size: | 2ug |
| Accessions: | BC008081 |
| Gene id: | 11014 |
| Gene description: | KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 |
| Synonyms: | ELP-1; ERD2.2; ER lumen protein-retaining receptor 2; (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2; ERD-2-like protein; ERD2-like protein 1; KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2; KDEL receptor 2; KDEL endoplasmic reticulum protein retention receptor 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacattttccggctgactggggacctgtcccacctggcggccatcgtcatcctgctgctgaagatctggaagacgcgctcctgcgccggtatttctgggaaaagccagcttctgtttgcactggtcttcacaactcgttacctggatctttttacttcatttatttcattgtataacacatctatgaaggttatctaccttgcctgctcctatgccacagtgtacctgatctacctgaaatttaaggcaacctacgatggaaatcatgataccttccgagtggagtttctggtggtccctgtgggaggcctctcatttttagttaatcacgatttctctcctcttgagatcctctggaccttctccatctacctggagtccgtggctatccttccgcagctgtttatgatcagcaagactggggaggccgagaccatcaccacccactacctgttcttcctgggcctctatcgtgctttgtatcttgtcaactggatctggcgcttctactttgagggcttctttgacctcattgctgtggtggccggcgtagtccagaccatcctatactgtgacttcttctacttgtacattacaaaagtactcaagggaaagaagctcagtttgccagcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 - myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 - pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 9 - 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) |