Cart 8 Product Products 1 074,10 € (empty)
-
1 x CBARA1-cal...121,50 € -
1 x RCAN1-regu...113,40 € -
1 x SYT9-synap...121,50 € -
1 x IGKV1-5-im...113,40 € -
-
1 x PLEKHA9-pl...121,50 € -
1 x ADAM7-ADAM...113,40 € -
1 x DHRS2-dehy...113,40 €
No products
To be determined Shipping
1 074,10 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 074,10 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 074,10 €
View larger 
AGPAT4-1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) Gene
PTXBC020209
New product
Data sheet of AGPAT4-1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AGPAT4-1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020209 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AGPAT4 |
| Origin species: | Human |
| Product name: | AGPAT4-1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) Gene |
| Size: | 2ug |
| Accessions: | BC020209 |
| Gene id: | 56895 |
| Gene description: | 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) |
| Synonyms: | 1-AGPAT4; LPAAT-delta; dJ473J16.2; 1-acyl-sn-glycerol-3-phosphate acyltransferase delta; 1-AGP acyltransferase 4; 1-AGPAT 4; 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta); lysophosphatidic acid acyltransferase delta; lysophosphatidic acid acyltransferase-delta (LPAAT-delta); 1-acylglycerol-3-phosphate O-acyltransferase 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacctcgcgggactgctgaagtctcagttcctgtgccacctggtcttctgctacgtctttattgcctcagggctaatcatcaacaccattcagctcttcactctcctcctctggcccattaacaagcagctcttccggaagatcaactgcagactgtcctattgcatctcaagccagctggtgatgctgctggagtggtggtcgggcacggaatgcaccatcttcacggacccgcgcgcctacctcaagtatgggaaggaaaatgccatcgtggttctcaaccacaagtttgaaattgactttctgtgtggctggagcctgtccgaacgctttgggctgttagggggctccaaggtcctggccaagaaagagctggcctatgtcccaattatcggctggatgtggtacttcaccgagatggtcttctgttcgcgcaagtgggagcaggatcgcaagacggttgccaccagtttgcagcacctccgggactaccccgagaagtattttttcctgattcactgtgagggcacacggttcacggagaagaagcatgagatcagcatgcaggtggcccgggccaaggggctgcctcgcctcaagcatcacctgttgccacgaaccaagggcttcgccatcaccgtgaggagcttgagaaatgtagtttcagctgtatatgactgtacactcaatttcagaaataatgaaaatccaacactgctgggagtcctaaacggaaagaaataccatgcagatttgtatgttaggaggatcccactggaagacatccctgaagacgatgacgagtgctcggcctggctgcacaagctctaccaggagaaggatgcctttcaggaggagtactacaggacgggcaccttcccagagacgcccatggtgcccccccggcggccctggaccctcgtgaactggctgttttgggcctcgctggtgctctaccctttcttccagttcctggtcagcatgatcaggagcgggtcttccctgacgctggccagcttcatcctcgtcttctttgtggcctctgtgggagttcgatggatgattggtgtgacggaaattgacaagggctctgcctacggcaactctgacagcaagcagaaactgaatgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 - pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4 - sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 - sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 |