SPOCK3-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 Gene View larger

SPOCK3-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 Gene

PTXBC013983

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPOCK3-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPOCK3-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013983
Product type: DNA & cDNA
Ncbi symbol: SPOCK3
Origin species: Human
Product name: SPOCK3-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 Gene
Size: 2ug
Accessions: BC013983
Gene id: 50859
Gene description: sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3
Synonyms: HSAJ1454; TES-3; TICN3; testican-3; sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3; SPARC/osteonectin, cwcv and kazal like domains proteoglycan 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctcaaggtgtcagccgtactgtgtgtgtgtgcagccgcttggtgcagtcagtctctcgcagctgccgcggcggtggctgcagccggggggcggtcggacggcggtaattttctggatgataaacaatggctcaccacaatctcccagtatgacaaggaagtcggacagtggaacaaattccgagacgatgattatttccgcacttggagtccaggaaaacccttcgatcaggctttagatccagctaaggatccatgcttaaagatgaaatgtagtcgccataaagtatgcattgctcaagattctcagactgcagtctgcattagtcaccggaggcttacacacaggatgaaagaagcaggagtagaccataggcagtggaggggtcccatattatccacctgcaagcagtgcccagtggtctatcccagccctgtttgtggttcagatggtcatacctactcttttcagtgcaaactagaatatcaggcatgtgtcttaggaaaacagatctcagtcaaatgtgaaggacattgcccatgtccttcagataagcccaccagtacaagcagaaatgttaagagagcatgcagtgacctggagttcagggaagtggcaaacagattgcgggactggttcaaggcccttcatgaaagtggaagtcaaaacaagaagacaaaaacattgctgaggcctgagagaagcagattcgataccagcatcttgccaatttgcaaggactcacttggctggatgtttaacagacttgatacaaactatgacctgctattggaccagtcagagctcagaagcatttaccttgataagaatgaacagtgtaccaaggcattcttcaattcttgtgacacatacaaggacagtttaatatctaataatgagtggtgctactgcttccagagacagcaagacccaccttgccagactgagctcagcaatattcagaagcggcaaggggtaaagaagctcctaggacagtatatccccctgtgtgatgaagatggttactacaagccaacacaatgtcatggcagtgttggacagtgctggtgtgttgacagatatggaaatgaagtcatgggatccagaataaatggtgttgcagattgtgctatagattttgagatctccggagattttgctagtggcgattttcatgaatggactgatgatgaggatgatgaagacgatattatgaatgatgaagatgaaattgaagatgatgatgaagatgaaggggatgatgatgatggtggtgatgaccatgatgtatacatttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
- scavenger receptor cysteine rich domain containing, group B (4 domains)
- protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform
- protein phosphatase 3 (formerly 2B), regulatory subunit B, alpha isoform

Buy SPOCK3-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 Gene now

Add to cart