Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SPOCK3-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 Gene
PTXBC013983
New product
Data sheet of SPOCK3-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPOCK3-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013983 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPOCK3 |
| Origin species: | Human |
| Product name: | SPOCK3-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 Gene |
| Size: | 2ug |
| Accessions: | BC013983 |
| Gene id: | 50859 |
| Gene description: | sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 |
| Synonyms: | HSAJ1454; TES-3; TICN3; testican-3; sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3; SPARC/osteonectin, cwcv and kazal like domains proteoglycan 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctcaaggtgtcagccgtactgtgtgtgtgtgcagccgcttggtgcagtcagtctctcgcagctgccgcggcggtggctgcagccggggggcggtcggacggcggtaattttctggatgataaacaatggctcaccacaatctcccagtatgacaaggaagtcggacagtggaacaaattccgagacgatgattatttccgcacttggagtccaggaaaacccttcgatcaggctttagatccagctaaggatccatgcttaaagatgaaatgtagtcgccataaagtatgcattgctcaagattctcagactgcagtctgcattagtcaccggaggcttacacacaggatgaaagaagcaggagtagaccataggcagtggaggggtcccatattatccacctgcaagcagtgcccagtggtctatcccagccctgtttgtggttcagatggtcatacctactcttttcagtgcaaactagaatatcaggcatgtgtcttaggaaaacagatctcagtcaaatgtgaaggacattgcccatgtccttcagataagcccaccagtacaagcagaaatgttaagagagcatgcagtgacctggagttcagggaagtggcaaacagattgcgggactggttcaaggcccttcatgaaagtggaagtcaaaacaagaagacaaaaacattgctgaggcctgagagaagcagattcgataccagcatcttgccaatttgcaaggactcacttggctggatgtttaacagacttgatacaaactatgacctgctattggaccagtcagagctcagaagcatttaccttgataagaatgaacagtgtaccaaggcattcttcaattcttgtgacacatacaaggacagtttaatatctaataatgagtggtgctactgcttccagagacagcaagacccaccttgccagactgagctcagcaatattcagaagcggcaaggggtaaagaagctcctaggacagtatatccccctgtgtgatgaagatggttactacaagccaacacaatgtcatggcagtgttggacagtgctggtgtgttgacagatatggaaatgaagtcatgggatccagaataaatggtgttgcagattgtgctatagattttgagatctccggagattttgctagtggcgattttcatgaatggactgatgatgaggatgatgaagacgatattatgaatgatgaagatgaaattgaagatgatgatgaagatgaaggggatgatgatgatggtggtgatgaccatgatgtatacatttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3 - scavenger receptor cysteine rich domain containing, group B (4 domains) - protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform - protein phosphatase 3 (formerly 2B), regulatory subunit B, alpha isoform |