Login to display prices
Login to display prices
SPOCK3-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 Gene View larger

SPOCK3-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 Gene

PTXBC013983

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPOCK3-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPOCK3-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 Gene

Proteogenix catalog: PTXBC013983
Ncbi symbol: SPOCK3
Product name: SPOCK3-sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 Gene
Size: 2ug
Accessions: BC013983
Gene id: 50859
Gene description: sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3
Synonyms: HSAJ1454; TES-3; TICN3; testican-3; sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3; SPARC/osteonectin, cwcv and kazal like domains proteoglycan 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctcaaggtgtcagccgtactgtgtgtgtgtgcagccgcttggtgcagtcagtctctcgcagctgccgcggcggtggctgcagccggggggcggtcggacggcggtaattttctggatgataaacaatggctcaccacaatctcccagtatgacaaggaagtcggacagtggaacaaattccgagacgatgattatttccgcacttggagtccaggaaaacccttcgatcaggctttagatccagctaaggatccatgcttaaagatgaaatgtagtcgccataaagtatgcattgctcaagattctcagactgcagtctgcattagtcaccggaggcttacacacaggatgaaagaagcaggagtagaccataggcagtggaggggtcccatattatccacctgcaagcagtgcccagtggtctatcccagccctgtttgtggttcagatggtcatacctactcttttcagtgcaaactagaatatcaggcatgtgtcttaggaaaacagatctcagtcaaatgtgaaggacattgcccatgtccttcagataagcccaccagtacaagcagaaatgttaagagagcatgcagtgacctggagttcagggaagtggcaaacagattgcgggactggttcaaggcccttcatgaaagtggaagtcaaaacaagaagacaaaaacattgctgaggcctgagagaagcagattcgataccagcatcttgccaatttgcaaggactcacttggctggatgtttaacagacttgatacaaactatgacctgctattggaccagtcagagctcagaagcatttaccttgataagaatgaacagtgtaccaaggcattcttcaattcttgtgacacatacaaggacagtttaatatctaataatgagtggtgctactgcttccagagacagcaagacccaccttgccagactgagctcagcaatattcagaagcggcaaggggtaaagaagctcctaggacagtatatccccctgtgtgatgaagatggttactacaagccaacacaatgtcatggcagtgttggacagtgctggtgtgttgacagatatggaaatgaagtcatgggatccagaataaatggtgttgcagattgtgctatagattttgagatctccggagattttgctagtggcgattttcatgaatggactgatgatgaggatgatgaagacgatattatgaatgatgaagatgaaattgaagatgatgatgaagatgaaggggatgatgatgatggtggtgatgaccatgatgtatacatttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: