Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SRCRB4D-scavenger receptor cysteine rich domain containing, group B (4 domains) Gene
PTXBC015651
New product
Data sheet of SRCRB4D-scavenger receptor cysteine rich domain containing, group B (4 domains) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SRCRB4D-scavenger receptor cysteine rich domain containing, group B (4 domains) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015651 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SRCRB4D |
| Origin species: | Human |
| Product name: | SRCRB4D-scavenger receptor cysteine rich domain containing, group B (4 domains) Gene |
| Size: | 2ug |
| Accessions: | BC015651 |
| Gene id: | 136853 |
| Gene description: | scavenger receptor cysteine rich domain containing, group B (4 domains) |
| Synonyms: | SRCRB4D; S4D-SRCRB; SRCRB-S4D; scavenger receptor cysteine-rich domain-containing group B protein; four scavenger receptor cysteine-rich domains-containing protein; scavenger receptor cysteine rich domain containing, group B (4 domains); scavenger receptor cysteine rich family, 4 domains; scavenger receptor cysteine-rich protein SRCRB-S4D; scavenger receptor cysteine rich family member with 4 domains |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactgggactttgcggacgcgcgcgtggcctgccgcgaagcgggctgcgggcctgcgctgggcgctacgggacgaggctcgcctgagcgactgcttccacctgggctggggccagcacaactgcggccaccacgaggacgcgggagcgctctgcgcaggtgaggctgacagcgaaggcccagaggagctgggactgcaagtccagcaggatggttctgagaccacgcgggtgcccactcctcggcccagggacgggcatctacgtctggtcaatggagcccaccgatgcgagggacgtgtagagctctacctagggcaacggtggggcactgtctgtgatgatgcttgggacctgcgggcagccggtgtcctgtgccgccagctgggctgtggccaggccctcgcagcccctggcgaggctcactttggcccaggccgaggccccattctcctggacaatgtcaagtgccgtggggaagaaagtgctctgctgctctgctctcatatccgctgggatgcccacaactgtgaccacagcgaggatgccagtgtcctgtgccagccttcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform - protein phosphatase 3 (formerly 2B), regulatory subunit B, alpha isoform - solute carrier family 25 (mitochondrial carrier: glutamate), member 22 - protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform |