PPP2R2B-protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform Gene View larger

PPP2R2B-protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform Gene

PTXBC031790

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPP2R2B-protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPP2R2B-protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031790
Product type: DNA & cDNA
Ncbi symbol: PPP2R2B
Origin species: Human
Product name: PPP2R2B-protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform Gene
Size: 2ug
Accessions: BC031790
Gene id: 5521
Gene description: protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform
Synonyms: B55BETA; PP2AB55BETA; PP2ABBETA; PP2APR55B; PP2APR55BETA; PR2AB55BETA; PR2ABBETA; PR2APR55BETA; PR52B; PR55-BETA; PR55BETA; SCA12; serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B beta isoform; PP2A subunit B isoform B55-beta; PP2A subunit B isoform PR55-beta; PP2A subunit B isoform R2-beta; PP2A, subunit B, B-beta isoform; protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform; protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform; protein phosphatase 2, regulatory subunit B, beta; serine/threonine protein phosphatase 2A, 55 kDa regulatory subunit B, beta isoform; serine/threonine protein phosphatase 2A, neuronal isoform; protein phosphatase 2 regulatory subunit Bbeta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggaggacattgatacccgcaaaatcaacaacagtttcctgcgcgaccacagctatgcgaccgaagctgacattatctctacggtagaattcaaccacacgggagaattactagcgacaggggacaaggggggtcgggttgtaatatttcaacgagagcaggagagtaaaaatcaggttcatcgtaggggtgaatacaatgtttacagcacattccagagccatgaacccgagttcgattacctgaagagtttagaaatagaagaaaaaatcaataaaataagatggctcccccagcagaatgcagcttactttcttctgtctactaatgataaaactgtgaagctgtggaaagtcagcgagcgtgataagaggccagaaggctacaatctgaaagatgaggagggccggctccgggatcctgccaccatcacaaccctgcgggtgcctgtcctgagacccatggacctgatggtggaggccaccccacgaagagtatttgccaacgcacacacatatcacatcaactccatatctgtcaacagcgactatgaaacctacatgtccgctgatgacctgaggattaacctatggaactttgaaataaccaatcaaagttttaatattgtggacattaagccagccaacatggaggagctcacggaggtgatcacagcagccgagttccacccccatcattgcaacaccttcgtgtacagcagcagcaaagggacaatccggctgtgtgacatgcgggcatctgccctgtgtgacaggcacaccaaattttttgaagagccggaagatccaagcaacagatcatttttctctgaaattatctcttcgatttcggatgtgaagttcagccacagtgggaggtatatcatgaccagggactacttgaccgtcaaagtctgggatctcaacatggaaaaccgccccatcgagacttaccaggttcatgactacctccgcagcaagctgtgttccctctatgaaaatgactgcatttttgataaatttgagtgtgtgtggaatgggtcagacagtgtcatcatgacaggctcctacaacaacttcttcaggatgttcgacagaaacaccaagcgtgatgtgacccttgaggcttcgagggaaaacagcaagccccgggctatcctcaaaccccgaaaagtgtgtgtggggggcaagcggagaaaagacgagatcagtgtcgacagtctggactttagcaaaaagatcttgcatacagcttggcatccttcagaaaatattatagcagtggcggctacaaataacctatatatattccaggacaaggttaactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III
- potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2
- potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
- ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide

Buy PPP2R2B-protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform Gene now

Add to cart