ATP5B-ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide Gene View larger

ATP5B-ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide Gene

PTXBC016512

New product

Data sheet of ATP5B-ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATP5B-ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC016512
Product type: DNA & cDNA
Ncbi symbol: ATP5B
Origin species: Human
Product name: ATP5B-ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide Gene
Size: 2ug
Accessions: BC016512
Gene id: 506
Gene description: ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
Synonyms: ATPMB; ATPSB; HEL-S-271; ATP synthase subunit beta, mitochondrial; epididymis secretory protein Li 271; mitochondrial ATP synthase beta subunit; mitochondrial ATP synthetase, beta subunit; ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttggggtttgtgggtcgggtggccgctgctccggcctccggggccttgcggagactcaccccttcagcgtcgctgcccccagctcagctcttactgcgggccgctccgacggcggtccatcctgtcagggactatgcggcgcaaacatctccttcgccaaaagcaggcgccgccaccgggcgcatcgtggcggtcattggcgcagtggtggacgtccagtttgatgagggactaccaccaattctaaatgccctggaagtgcaaggcagggagaccagactggttttggaggtggcccagcatttgggtgagagcacagtaaggactattgctatggatggtacagaaggcttggttagaggccagaaagtactggattctggtgcaccaatcaaaattcctgttggtcctgagactttgggcagaatcatgaatgtcattggagaacctattgatgaaagaggtcccatcaaaaccaaacaatttgctcccattcatgctgaggctccagagttcatggaaatgagtgttgagcaggaaattctggtgactggtatcaaggttgtcgatctgctagctccctatgccaagggtggcaaaattgggctttttggtggtgctggagttggcaagactgtactgatcatggagttaatcaacaatgtcgccaaagcccatggtggttactctgtgtttgctggtgttggtgagaggacccgtgaaggcaatgatttataccatgaaatgattgaatctggtgttatcaacttaaaagatgccacctctaaggtagcgctggtatatggtcaaatgaatgaaccacctggtgctcgtgcccgggtagctctgactgggctgactgtggctgaatacttcagagaccaagaaggtcaagatgtactgctatttattgataacatctttcgcttcacccaggctggttcagaggtgtctgcattattgggccgaatcccttctgctgtgggctatcagcctaccctggccactgacatgggtactatgcaggaaagaattaccactaccaagaagggatctatcacctctgtacaggctatctatgtgcctgctgatgacttgactgaccctgcccctgctactacgtttgcccatttggatgctaccactgtactgtcgcgtgccattgctgagctgggcatctatccagctgtggatcctctagactccacctctcgtatcatggatcccaacattgttggcagtgagcattacgatgttgcccgtggggtgcaaaagatcctgcaggactacaaatccctccaggatatcattgccatcctgggtatggatgaactttctgaggaagacaagttgaccgtgtcccgtgcacggaaaatacagcgtttcttgtctcagccattccaggttgctgaggtcttcacaggtcatatggggaagctggtacccctgaaggagaccatcaaaggattccagcagattttggcaggtgaatatgaccatctcccagaacaggccttctatatggtgggacccattgaagaagctgtggcaaaagctgataagctggctgaagagcattcatcgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)
- solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5
- 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)
- tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain

Buy ATP5B-ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide Gene now

Add to cart