Login to display prices
Login to display prices
TNFRSF10D-tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain Gene View larger

TNFRSF10D-tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain Gene

PTXBC052270

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TNFRSF10D-tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TNFRSF10D-tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain Gene

Proteogenix catalog: PTXBC052270
Ncbi symbol: TNFRSF10D
Product name: TNFRSF10D-tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain Gene
Size: 2ug
Accessions: BC052270
Gene id: 8793
Gene description: tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain
Synonyms: CD264; DCR2; TRAIL-R4; TRAILR4; TRUNDD; tumor necrosis factor receptor superfamily member 10D; TNF receptor-related receptor for TRAIL; TNF-related apoptosis-inducing ligand receptor 4; TRAIL receptor 4; TRAIL receptor with a truncated death domain; decoy receptor 2; tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain; TNF receptor superfamily member 10d
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggactttggggacaaagcgtcccgaccgcctcgagcgctcgagcagggcgctatccaggagccaggacagcgtcgggaaccagaccatggctcctggaccccaagatccttaagttcgtcgtcttcatcgtcgcggttctgctgccggtccgggttgactctgccaccatcccccggcaggacgaagttccccagcagacagtggccccacagcaacagaggcgcagcctcaaggaggaggagtgtccagcaggatctcatagatcagaatatactggagcctgtaacccgtgcacagagggtgtggattacaccattgcttccaacaatttgccttcttgcctgctatgtacagtttgtaaatcaggtcaaacaaataaaagttcctgtaccacgaccagagacaccgtgtgtcagtgtgaaaaaggaagcttccaggataaaaactcccctgagatgtgccggacgtgtagaacagggtgtcccagagggatggtcaaggtcagtaattgtacgccccggagtgacatcaagtgcaaaaatgaatcagctgccagttccactgggaaaaccccagcagcggaggagacagtgaccaccatcctggggatgcttgcctctccctatcactaccttatcatcatagtggttttagtcatcattttagctgtggttgtggttggcttttcatgtcggaagaaattcatttcttacctcaaaggcatctgctcaggtggtggaggaggtcccgaacgtgtgcacagagtccttttccggcggcgttcatgtccttcacgagttcctggggcggaggacaatgcccgcaacgagaccctgagtaacagatacttgcagcccacccaggtctctgagcaggaaatccaaggtcaggagctggcagagctaacaggtgtgactgtagagtcgccagaggagccacagcgtctgctggaacaggcagaagctgaagggtgtcagaggaggaggctgctggttccagtgaatgacgctgactccgctgacatcagcaccttgctggatgcctcggcaacactggaagaaggacatgcaaaggaaacaattcaggaccaactggtgggctccgaaaagctcttttatgaagaagatgaggcaggctctgctacgtcctgcctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: