Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TNFRSF10D-tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain Gene
PTXBC052270
New product
Data sheet of TNFRSF10D-tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNFRSF10D-tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC052270 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNFRSF10D |
| Origin species: | Human |
| Product name: | TNFRSF10D-tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain Gene |
| Size: | 2ug |
| Accessions: | BC052270 |
| Gene id: | 8793 |
| Gene description: | tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain |
| Synonyms: | CD264; DCR2; TRAIL-R4; TRAILR4; TRUNDD; tumor necrosis factor receptor superfamily member 10D; TNF receptor-related receptor for TRAIL; TNF-related apoptosis-inducing ligand receptor 4; TRAIL receptor 4; TRAIL receptor with a truncated death domain; decoy receptor 2; tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain; TNF receptor superfamily member 10d |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggactttggggacaaagcgtcccgaccgcctcgagcgctcgagcagggcgctatccaggagccaggacagcgtcgggaaccagaccatggctcctggaccccaagatccttaagttcgtcgtcttcatcgtcgcggttctgctgccggtccgggttgactctgccaccatcccccggcaggacgaagttccccagcagacagtggccccacagcaacagaggcgcagcctcaaggaggaggagtgtccagcaggatctcatagatcagaatatactggagcctgtaacccgtgcacagagggtgtggattacaccattgcttccaacaatttgccttcttgcctgctatgtacagtttgtaaatcaggtcaaacaaataaaagttcctgtaccacgaccagagacaccgtgtgtcagtgtgaaaaaggaagcttccaggataaaaactcccctgagatgtgccggacgtgtagaacagggtgtcccagagggatggtcaaggtcagtaattgtacgccccggagtgacatcaagtgcaaaaatgaatcagctgccagttccactgggaaaaccccagcagcggaggagacagtgaccaccatcctggggatgcttgcctctccctatcactaccttatcatcatagtggttttagtcatcattttagctgtggttgtggttggcttttcatgtcggaagaaattcatttcttacctcaaaggcatctgctcaggtggtggaggaggtcccgaacgtgtgcacagagtccttttccggcggcgttcatgtccttcacgagttcctggggcggaggacaatgcccgcaacgagaccctgagtaacagatacttgcagcccacccaggtctctgagcaggaaatccaaggtcaggagctggcagagctaacaggtgtgactgtagagtcgccagaggagccacagcgtctgctggaacaggcagaagctgaagggtgtcagaggaggaggctgctggttccagtgaatgacgctgactccgctgacatcagcaccttgctggatgcctcggcaacactggaagaaggacatgcaaaggaaacaattcaggaccaactggtgggctccgaaaagctcttttatgaagaagatgaggcaggctctgctacgtcctgcctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 22 (organic anion/urate transporter), member 11 - glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast) - protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform - glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast) |