Login to display prices
Login to display prices
GPAA1-glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast) Gene View larger

GPAA1-glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast) Gene

PTXBC006383

New product

Data sheet of GPAA1-glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GPAA1-glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast) Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC006383
Product type: DNA & cDNA
Ncbi symbol: GPAA1
Origin species: Human
Product name: GPAA1-glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast) Gene
Size: 2ug
Accessions: BC006383
Gene id: 8733
Gene description: glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast)
Synonyms: GAA1; hGAA1; glycosylphosphatidylinositol anchor attachment 1 protein; GAA1 protein homolog; GPAA1P anchor attachment protein 1 homolog; GPI anchor attachment protein 1; GPI transamidase subunit; anchor attachment protein 1 (Gaa1p, yeast) homolog; glycophosphatidylinositol anchor attachment 1; glycosylphosphatidylinositol anchor attachment protein 1 homolog; glycosylphosphatidylinositol anchor attachment 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcctcctgtcggacccggttcgccggcgcgcgctcgcccgcctagtgctgcgcctcaacgcgccgttgtgggctctgccagtggcctggcttgaacggacgatgcggtcagtagggctggaggtctacacgcagagtttctcccggaaactgcccttcccagatgagacccacgagcgctatatggtgtcgggcaccaacgtgtacggcatcctgcgggccccgcgtgctgccagcaccgagtcgcttgtgctcaccgtgccctgtggctctgactctaccaacagccaggctgtggggctgctgctggcactggctgcccacttccgggggcagatttattgggccaaagatatcgtcttcctggtaacagaacatgaccttctgggcactgaggcttggcttgaagcctaccacgatgtcaatgtcactggcatgcagtcgtctcccctgcagggccgagctggggccattcaggcagccgtggccctggagctgagcagtgatgtggtcaccagcctcgatgtggccgtggaggggcttaacgggcagctgcccaaccttgacctgctcaatctcttccagaccttctgccagaaagggggcctgttgtgcacgcttcagggcaagctgcagcccgaggactggacatcattggatggaccgctgcagggcctgcagacactgctgctcatggttctgcggcaggcctccggccgcccccacggctcccatggcctcttcctgcgctaccgtgtggaggccctaaccctgcgtggcatcaatagcttccgccagtacaagtatgacctggtggcagtgggcaaggctttggagggcatgttccgcaagctcaaccacctcctggagcgcctgcaccagtccttcttcctctacttgctccccggcctctcccgcttcgtctccatcggcctctacatgcccgctgtcggcttcttgctcctggtccttggtctcaaggctctggaactgtggatgcagctgcatgaggctggaatgggccttgaggagcccgggggtgcccctggccccagtgtaccccttcccccatcacagggtgtggggctggcctcgctcgtggcacctctgctgatctcacaggccatgggactggccctctatgtcctgccagtgctgggccaacacgttgccacccagcacttcccagtggcagaggctgaggctgtggtgctgacactgctggcgatttatgcagctggcctggccctgccccacaatacccaccgggtggtaagcacacaggccccagacaggggctggatggcactgaagctggtagccctgatctacctagcactgcagctgggctgcatcgccctcaccaacttctcactgggcttcctgctggccaccaccatggtgcccactgctgcgcttgccaagcctcatgggccccggaccctctatgctgccctgctggtgctgaccagcccggcagccacgctccttggcagcctgttcctgtggcgggagctgcaggaggcgccactgtcactggccgagggctggcagctcttcctggcagcgctagcccagggtgtgctggagcaccacacctacggcgccctgctcttcccactgctgtccctgggcctctacccctgctggctgcttttctggaatgtgctcttctggaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform
- glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast)
- E74-like factor 3 (ets domain transcription factor, epithelial-specific )
- solute carrier family 16, member 4 (monocarboxylic acid transporter 5)