Login to display prices
Login to display prices
ELF3-E74-like factor 3 (ets domain transcription factor, epithelial-specific ) Gene View larger

ELF3-E74-like factor 3 (ets domain transcription factor, epithelial-specific ) Gene

PTXBC003569

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ELF3-E74-like factor 3 (ets domain transcription factor, epithelial-specific ) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ELF3-E74-like factor 3 (ets domain transcription factor, epithelial-specific ) Gene

Proteogenix catalog: PTXBC003569
Ncbi symbol: ELF3
Product name: ELF3-E74-like factor 3 (ets domain transcription factor, epithelial-specific ) Gene
Size: 2ug
Accessions: BC003569
Gene id: 1999
Gene description: E74-like factor 3 (ets domain transcription factor, epithelial-specific )
Synonyms: EPR-1; ERT; ESE-1; ESX; ETS-related transcription factor Elf-3; E74-like factor 3 (ETS domain transcription factor, serine box, epithelial-specific); E74-like factor 3 (ets domain transcription factor); E74-like factor 3 (ets domain transcription factor, epithelial-specific ); epithelial-restricted with serine box; epithelium-restricted Ets protein ESX; epithelium-specific Ets transcription factor 1; ets domain transcription factor, serine box (epithelial-specific); E74 like ETS transcription factor 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcaacctgtgagattagcaacatttttagcaactacttcagtgcgatgtacagctcggaggactccaccctggcctctgttccccctgctgccacctttggggccgatgacttggtactgaccctgagcaacccccagatgtcattggagggtacagagaaggccagctggttgggggaacagccccagttctggtcgaagacgcaggttctggactggatcagctaccaagtggagaagaacaagtacgacgcaagcgccattgacttctcacgatgtgacatggatggcgccaccctctgcaattgtgcccttgaggagctgcgtctggtctttgggcctctgggggaccaactccatgcccagctgcgagacctcacttccagctcttctgatgagctcagttggatcattgagctgctggagaaggatggcatggccttccaggaggccctagacccagggccctttgaccagggcagcccctttgcccaggagctgctggacgacggtcagcaagccagcccctaccaccccggcagctgtggcgcaggagccccctcccctggcagctctgacgtctccaccgcagggactggtgcttctcggagctcccactcctcagactccggtggaagtgacgtggacctggatcccactgatggcaagctcttccccagcgatggttttcgtgactgcaagaagggggatcccaagcacgggaagcggaaacgaggccggccccgaaagctgagcaaagagtactgggactgtctcgagggcaagaagagcaagcacgcgcccagaggcacccacctgtgggagttcatccgggacatcctcatccacccggagctcaacgagggcctcatgaagtgggagaatcggcatgaaggcgtcttcaagttcctgcgctccgaggctgtggcccaactatggggccaaaagaaaaagaacagcaacatgacctacgagaagctgagccgggccatgaggtactactacaaacgggagatcctggaacgggtggatggccggcgactcgtctacaagtttggcaaaaactcaagcggctggaaggaggaagaggttctccagagtcggaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: