Login to display prices
Login to display prices
SLC16A7-solute carrier family 16, member 7 (monocarboxylic acid transporter 2) Gene View larger

SLC16A7-solute carrier family 16, member 7 (monocarboxylic acid transporter 2) Gene

PTXBC030693

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC16A7-solute carrier family 16, member 7 (monocarboxylic acid transporter 2) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC16A7-solute carrier family 16, member 7 (monocarboxylic acid transporter 2) Gene

Proteogenix catalog: PTXBC030693
Ncbi symbol: SLC16A7
Product name: SLC16A7-solute carrier family 16, member 7 (monocarboxylic acid transporter 2) Gene
Size: 2ug
Accessions: BC030693
Gene id: 9194
Gene description: solute carrier family 16, member 7 (monocarboxylic acid transporter 2)
Synonyms: MCT2; monocarboxylate transporter 2; solute carrier family 16 (monocarboxylate transporter), member 7; solute carrier family 16, member 7 (monocarboxylic acid transporter 2); solute carrier family 16 member 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccaccaatgccaagtgccccacctgtgcatccacctccagatggaggatggggttggattgtggttggagcagcttttatctccattggattttcctatgcattccccaaagctgtcaccgtattcttcaaagaaattcagcaaatattccacactacctacagtgaaatagcatggatttcatccattatgctggctgttatgtacgcaggaggtcctgtaagtagtgttttggtgaataaatacggcagccggccggtggtgatagcaggaggcttattatgctgtcttggaatggtgttggcctcctttagtagcagcgtggtacagctgtacctcactatgggattcattacaggtttaggtttagccttcaacctgcaacccgccttaaccataattggcaaatacttctataggaagcgacccatggcaaatggattggccatggcaggaagtcctgttttcttaagttcattggctcctttcaatcagtacctttttaatacttttggctggaaaggaagcttcctgattttgggaagtctacttttgaatgcctgtgtggctggttccctcatgagaccccttggacccaatcaaaccacttctaagtctaaaaataagactggcaaaacagaagatgattcaagcccaaagaaaatcaaaacgaagaaatcaacttgggaaaaagttaataagtatttagatttctccctttttaagcatagaggatttctgatatatctgtctggaaatgtcattatgttcctaggtttttttgcccccattatattcttggctccatatgctaaagaccaaggaattgatgagtactcggcagcttttctgctatctgttatggctttcgttgatatgtttgctaggccttctgtaggattaattgcaaactccaaatatattcgacctcgaattcagtacttcttcagttttgcaatcatgttcaatggagtgtgtcacctcttgtgcccactggcacaggactacacaagcctggtattatatgctgtattttttggccttggatttgggagtgttagcagtgttctctttgaaactctcatggacctcgtgggtgcaccaagattttccagtgccgtcggacttgtcacaattgtggagtgtggcccagttcttcttggccctcctcttgcaggtaaattggtggatttaactggagaatataaatacatgtacatgtcctgtggggctattgtggtagcagcaagcgtgtggctgctcattggcaatgctatcaactatagattgcttgcaaaggaaaggaaggaggaaaatgcaaggcagaagaccagagaatctgaacccttgagcaaatctaaacattcggaagatgttaacgtcaaagtttcaaatgcacagagtgtaacctcagaaagagaaactaacatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: