Cart 3 Product Products 364,50 € (empty)
-
1 x SLC16A7-so...121,50 € -
1 x FBXO28-F-b...121,50 € -
1 x PPM1A-prot...121,50 €
No products
To be determined Shipping
364,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 364,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 364,50 €
View larger 
AKR7A3-aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) Gene
PTXBC025709
New product
Data sheet of AKR7A3-aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AKR7A3-aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025709 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AKR7A3 |
| Origin species: | Human |
| Product name: | AKR7A3-aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) Gene |
| Size: | 2ug |
| Accessions: | BC025709 |
| Gene id: | 22977 |
| Gene description: | aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) |
| Synonyms: | AFAR2; aflatoxin B1 aldehyde reductase member 3; AFB1 aldehyde reductase 2; AFB1-AR 2; aflatoxin B1 aldehyde reductase 2; aflatoxin aldehyde reductase; aldo-keto reductase family 7 member A3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcccggcagctgtcgcgggcccggccagccacggtgctgggcgccatggagatggggcgccgcatggacgcgcccaccagcgccgcagtcacgcgcgccttcctggagcgcggccacaccgagatagacacggccttcgtgtacagcgagggccagtccgagaccatccttggcggcctggggctccggctgggcggcagcgactgcagagtgaaaattgataccaaggccattccactgtttgggaactccctgaagcctgacagtctccggttccagctggagacgtcactgaagcggctgcagtgtccccgagtggacctcttctacctgcatatgccagaccacagcaccccggtggaagagacactgcgtgcctgccaccagctgcaccaggagggcaagttcgtggagcttggcctctccaactatgcagcctgggaagtggccgagatctgtaccctctgcaagagcaacggctggatcctgcccactgtctaccagggcatgtacaatgccatcacccggcaggtggaaacggagctcttcccctgcctcaggcactttggactgaggttctatgccttcaaccctctggctgggggcctgctgaccggcaagtacaagtatgaggacaaggatgggaaacagcccgtgggccgcttctttgggaatacctgggcagagatgtacaggaatcgctactggaaggagcaccactttgagggcattgccctggtggagaaggccctgcaggccgcgtatggcgccagcgcccccagcatgacctcggccaccctccggtggatgtaccaccactcacagctgcagggtgcccacggggacgcggtcatcctgggcatgtccagcctggagcagctggagcagaacttggcagcggcagaggaagggcccctggagccggctgtcgtggacgcctttaatcaagcctggcatttggttgctcacgaatgtcccaactacttccgctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - guanine nucleotide binding protein (G protein), beta polypeptide 1-like - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1 - neural precursor cell expressed, developmentally down-regulated 4-like - protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform |