Login to display prices
Login to display prices
AKR7A3-aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) Gene View larger

AKR7A3-aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) Gene

PTXBC025709

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AKR7A3-aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AKR7A3-aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) Gene

Proteogenix catalog: PTXBC025709
Ncbi symbol: AKR7A3
Product name: AKR7A3-aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) Gene
Size: 2ug
Accessions: BC025709
Gene id: 22977
Gene description: aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)
Synonyms: AFAR2; aflatoxin B1 aldehyde reductase member 3; AFB1 aldehyde reductase 2; AFB1-AR 2; aflatoxin B1 aldehyde reductase 2; aflatoxin aldehyde reductase; aldo-keto reductase family 7 member A3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcccggcagctgtcgcgggcccggccagccacggtgctgggcgccatggagatggggcgccgcatggacgcgcccaccagcgccgcagtcacgcgcgccttcctggagcgcggccacaccgagatagacacggccttcgtgtacagcgagggccagtccgagaccatccttggcggcctggggctccggctgggcggcagcgactgcagagtgaaaattgataccaaggccattccactgtttgggaactccctgaagcctgacagtctccggttccagctggagacgtcactgaagcggctgcagtgtccccgagtggacctcttctacctgcatatgccagaccacagcaccccggtggaagagacactgcgtgcctgccaccagctgcaccaggagggcaagttcgtggagcttggcctctccaactatgcagcctgggaagtggccgagatctgtaccctctgcaagagcaacggctggatcctgcccactgtctaccagggcatgtacaatgccatcacccggcaggtggaaacggagctcttcccctgcctcaggcactttggactgaggttctatgccttcaaccctctggctgggggcctgctgaccggcaagtacaagtatgaggacaaggatgggaaacagcccgtgggccgcttctttgggaatacctgggcagagatgtacaggaatcgctactggaaggagcaccactttgagggcattgccctggtggagaaggccctgcaggccgcgtatggcgccagcgcccccagcatgacctcggccaccctccggtggatgtaccaccactcacagctgcagggtgcccacggggacgcggtcatcctgggcatgtccagcctggagcagctggagcagaacttggcagcggcagaggaagggcccctggagccggctgtcgtggacgcctttaatcaagcctggcatttggttgctcacgaatgtcccaactacttccgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: