AKR7A3-aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) Gene View larger

AKR7A3-aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) Gene

PTXBC025709

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AKR7A3-aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AKR7A3-aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025709
Product type: DNA & cDNA
Ncbi symbol: AKR7A3
Origin species: Human
Product name: AKR7A3-aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) Gene
Size: 2ug
Accessions: BC025709
Gene id: 22977
Gene description: aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)
Synonyms: AFAR2; aflatoxin B1 aldehyde reductase member 3; AFB1 aldehyde reductase 2; AFB1-AR 2; aflatoxin B1 aldehyde reductase 2; aflatoxin aldehyde reductase; aldo-keto reductase family 7 member A3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcccggcagctgtcgcgggcccggccagccacggtgctgggcgccatggagatggggcgccgcatggacgcgcccaccagcgccgcagtcacgcgcgccttcctggagcgcggccacaccgagatagacacggccttcgtgtacagcgagggccagtccgagaccatccttggcggcctggggctccggctgggcggcagcgactgcagagtgaaaattgataccaaggccattccactgtttgggaactccctgaagcctgacagtctccggttccagctggagacgtcactgaagcggctgcagtgtccccgagtggacctcttctacctgcatatgccagaccacagcaccccggtggaagagacactgcgtgcctgccaccagctgcaccaggagggcaagttcgtggagcttggcctctccaactatgcagcctgggaagtggccgagatctgtaccctctgcaagagcaacggctggatcctgcccactgtctaccagggcatgtacaatgccatcacccggcaggtggaaacggagctcttcccctgcctcaggcactttggactgaggttctatgccttcaaccctctggctgggggcctgctgaccggcaagtacaagtatgaggacaaggatgggaaacagcccgtgggccgcttctttgggaatacctgggcagagatgtacaggaatcgctactggaaggagcaccactttgagggcattgccctggtggagaaggccctgcaggccgcgtatggcgccagcgcccccagcatgacctcggccaccctccggtggatgtaccaccactcacagctgcagggtgcccacggggacgcggtcatcctgggcatgtccagcctggagcagctggagcagaacttggcagcggcagaggaagggcccctggagccggctgtcgtggacgcctttaatcaagcctggcatttggttgctcacgaatgtcccaactacttccgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - guanine nucleotide binding protein (G protein), beta polypeptide 1-like
- NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1
- neural precursor cell expressed, developmentally down-regulated 4-like
- protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform

Buy AKR7A3-aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) Gene now

Add to cart