Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PPM1B-protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform Gene
PTXBC012002
New product
Data sheet of PPM1B-protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPM1B-protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012002 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPM1B |
| Origin species: | Human |
| Product name: | PPM1B-protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform Gene |
| Size: | 2ug |
| Accessions: | BC012002 |
| Gene id: | 5495 |
| Gene description: | protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform |
| Synonyms: | PP2C-beta; PP2C-beta-X; PP2CB; PP2CBETA; PPC2BETAX; protein phosphatase 1B; Ser/Thr protein phosphatase type 2C beta 2 isoform; protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform; protein phosphatase 2C-like protein; protein phosphatase, Mg2+/Mn2+ dependent 1B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtattgtactagtttgcttttcaaatgctcccaaggtctcagatgaagcggtgaaaaaagattcagagttggataagcacttggaatcacgggttgaagagattatggagaagtctggcgaggaaggaatgcctgatcttgcccatgtcatgcgcatcttgtctgcagaaaatatcccaaatttgcctcctgggggaggtcttgctggcaagcgtaatgttattgaagctgtttatagtagactgaatccacatagagaaagtgatggggcctccgatgaagcagaggaaagtggatcacagggaaaattggtggaagctctcaggcaaatgagaattaatcataggggaaactaccgacaacttctggaggagatgctgactagttacaggctagctaaagtagagggagaagaaagccctgctgaaccagctgccacagctacttcttcgaacagtgatgctggaaacccagtgacaatgcaggaaagccatactgaatcagaaagtggtcttgctgaattagacagctctaatgaagatgcagggacaaagatgagtggtgaaaaaatatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein with EGF-like and two follistatin-like domains 1 - solute carrier family 6 (neurotransmitter transporter, GABA), member 1 - core-binding factor, runt domain, alpha subunit 2; translocated to, 2 - core-binding factor, runt domain, alpha subunit 2; translocated to, 2 |