Login to display prices
Login to display prices
PPM1B-protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform Gene View larger

PPM1B-protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform Gene

PTXBC012002

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPM1B-protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPM1B-protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform Gene

Proteogenix catalog: PTXBC012002
Ncbi symbol: PPM1B
Product name: PPM1B-protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform Gene
Size: 2ug
Accessions: BC012002
Gene id: 5495
Gene description: protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform
Synonyms: PP2C-beta; PP2C-beta-X; PP2CB; PP2CBETA; PPC2BETAX; protein phosphatase 1B; Ser/Thr protein phosphatase type 2C beta 2 isoform; protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform; protein phosphatase 2C-like protein; protein phosphatase, Mg2+/Mn2+ dependent 1B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtattgtactagtttgcttttcaaatgctcccaaggtctcagatgaagcggtgaaaaaagattcagagttggataagcacttggaatcacgggttgaagagattatggagaagtctggcgaggaaggaatgcctgatcttgcccatgtcatgcgcatcttgtctgcagaaaatatcccaaatttgcctcctgggggaggtcttgctggcaagcgtaatgttattgaagctgtttatagtagactgaatccacatagagaaagtgatggggcctccgatgaagcagaggaaagtggatcacagggaaaattggtggaagctctcaggcaaatgagaattaatcataggggaaactaccgacaacttctggaggagatgctgactagttacaggctagctaaagtagagggagaagaaagccctgctgaaccagctgccacagctacttcttcgaacagtgatgctggaaacccagtgacaatgcaggaaagccatactgaatcagaaagtggtcttgctgaattagacagctctaatgaagatgcagggacaaagatgagtggtgaaaaaatatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: