Login to display prices
Login to display prices
TMEFF1-transmembrane protein with EGF-like and two follistatin-like domains 1 Gene View larger

TMEFF1-transmembrane protein with EGF-like and two follistatin-like domains 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEFF1-transmembrane protein with EGF-like and two follistatin-like domains 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEFF1-transmembrane protein with EGF-like and two follistatin-like domains 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035056
Product type: DNA & cDNA
Ncbi symbol: TMEFF1
Origin species: Human
Product name: TMEFF1-transmembrane protein with EGF-like and two follistatin-like domains 1 Gene
Size: 2ug
Accessions: BC035056
Gene id: 8577
Gene description: transmembrane protein with EGF-like and two follistatin-like domains 1
Synonyms: C9orf2; CT120.1; H7365; TR-1; tomoregulin-1; cancer/testis antigen family 120, member 1; transmembrane protein with EGF-like and one follistatin-like domain; transmembrane protein with EGF like and two follistatin like domains 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcgccgcagccgctgaggcgccgctccggctgcctgccgcgcctccgctcgccttctgctgctacacgtcggtgcttctgctcttcgccttctctctgccagggagccgcgcgtccaaccagcccccgggtggtggcggcggcagcggcggggactgtcccggcggcaaaggcaagagcatcaactgctcagaattaaatgtgagggagtctgacgtaagagtttgtgatgagtcatcatgtaaatatggaggagtctgtaaagaagatggagatggtttgaaatgtgcatgccaatttcagtgccatacaaattatattcctgtctgtggatcaaatggggacacttatcaaaatgaatgctttctcagaagggctgcttgtaagcaccagaaagagataacagtaatagcaagaggaccatgctactctgataatggatctggatctggagaaggagaagaggaagggtcaggggcagaagttcacagaaaacactccaagtgtggaccctgcaaatataaagctgagtgtgatgaagatgcagaaaatgttgggtgtgtatgtaatatagattgcagtggatacagttttaatcctgtgtgtgcttctgatgggagttcctataacaatccctgttttgttcgagaagcatcttgtataaagcaagaacaaattgatataaggcatcttggtcattgcacagatacagatgacactagtttgttgggaaagaaagatgatggactacaatatcgaccagatgtgaaagatgctagtgatcaaagagaagatgtttatattggaaaccacatgccttgccctgaaaacctcaatggttactgcatccatggaaaatgtgaattcatctattctactcagaaggcttcttgtagatgtgaatctggctacactggacagcactgtgaaaagacagactttagtattctctatgtagtgccaagtaggcaaaagctcactcatgttcttattgcagcaattattggagctgtacagattgccatcatagtagcaattgtaatgtgcataacaagaaaatgccccaaaaacaatagaggacgtcgacagaagcaaaacctaggtcattttacttcagatacgtcatccagaatggtttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 6 (neurotransmitter transporter, GABA), member 1
- core-binding factor, runt domain, alpha subunit 2; translocated to, 2
- core-binding factor, runt domain, alpha subunit 2; translocated to, 2
- aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)