Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TMEFF1-transmembrane protein with EGF-like and two follistatin-like domains 1 Gene
PTXBC035056
New product
Data sheet of TMEFF1-transmembrane protein with EGF-like and two follistatin-like domains 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEFF1-transmembrane protein with EGF-like and two follistatin-like domains 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC035056 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEFF1 |
| Origin species: | Human |
| Product name: | TMEFF1-transmembrane protein with EGF-like and two follistatin-like domains 1 Gene |
| Size: | 2ug |
| Accessions: | BC035056 |
| Gene id: | 8577 |
| Gene description: | transmembrane protein with EGF-like and two follistatin-like domains 1 |
| Synonyms: | C9orf2; CT120.1; H7365; TR-1; tomoregulin-1; cancer/testis antigen family 120, member 1; transmembrane protein with EGF-like and one follistatin-like domain; transmembrane protein with EGF like and two follistatin like domains 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcgccgcagccgctgaggcgccgctccggctgcctgccgcgcctccgctcgccttctgctgctacacgtcggtgcttctgctcttcgccttctctctgccagggagccgcgcgtccaaccagcccccgggtggtggcggcggcagcggcggggactgtcccggcggcaaaggcaagagcatcaactgctcagaattaaatgtgagggagtctgacgtaagagtttgtgatgagtcatcatgtaaatatggaggagtctgtaaagaagatggagatggtttgaaatgtgcatgccaatttcagtgccatacaaattatattcctgtctgtggatcaaatggggacacttatcaaaatgaatgctttctcagaagggctgcttgtaagcaccagaaagagataacagtaatagcaagaggaccatgctactctgataatggatctggatctggagaaggagaagaggaagggtcaggggcagaagttcacagaaaacactccaagtgtggaccctgcaaatataaagctgagtgtgatgaagatgcagaaaatgttgggtgtgtatgtaatatagattgcagtggatacagttttaatcctgtgtgtgcttctgatgggagttcctataacaatccctgttttgttcgagaagcatcttgtataaagcaagaacaaattgatataaggcatcttggtcattgcacagatacagatgacactagtttgttgggaaagaaagatgatggactacaatatcgaccagatgtgaaagatgctagtgatcaaagagaagatgtttatattggaaaccacatgccttgccctgaaaacctcaatggttactgcatccatggaaaatgtgaattcatctattctactcagaaggcttcttgtagatgtgaatctggctacactggacagcactgtgaaaagacagactttagtattctctatgtagtgccaagtaggcaaaagctcactcatgttcttattgcagcaattattggagctgtacagattgccatcatagtagcaattgtaatgtgcataacaagaaaatgccccaaaaacaatagaggacgtcgacagaagcaaaacctaggtcattttacttcagatacgtcatccagaatggtttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 6 (neurotransmitter transporter, GABA), member 1 - core-binding factor, runt domain, alpha subunit 2; translocated to, 2 - core-binding factor, runt domain, alpha subunit 2; translocated to, 2 - aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) |