Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GNB1L-guanine nucleotide binding protein (G protein), beta polypeptide 1-like Gene
PTXBC012060
New product
Data sheet of GNB1L-guanine nucleotide binding protein (G protein), beta polypeptide 1-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GNB1L-guanine nucleotide binding protein (G protein), beta polypeptide 1-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012060 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GNB1L |
| Origin species: | Human |
| Product name: | GNB1L-guanine nucleotide binding protein (G protein), beta polypeptide 1-like Gene |
| Size: | 2ug |
| Accessions: | BC012060 |
| Gene id: | 54584 |
| Gene description: | guanine nucleotide binding protein (G protein), beta polypeptide 1-like |
| Synonyms: | DGCRK3; FKSG1; GY2; WDR14; WDVCF; guanine nucleotide-binding protein subunit beta-like protein 1; G-protein beta subunit-like protein; WD repeat-containing protein 14; WD40 repeat-containing protein deleted in VCFS; g protein subunit beta-like protein 1; guanine nucleotide binding protein (G protein), beta polypeptide 1-like; guanine nucleotide binding protein beta-subunit-like polypeptide; G protein subunit beta 1 like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacggccccctgcccgccgccacctccagacccccagtttgtcctccgaggcacccagtcaccggtgcatgcgctgcacttctgcgaaggagcccaggctcaggggcgcccgctcctcttctcagggtctcagagtggcctggtacacatctggagcctgcagacgcggagagcggttaccaccctggatggccacggcggccagtgtgtgacctggctgcagacgctgccccaggggcgccagctcctcagtcagggccgggacctgaagctgtgcctgtgggacctcgcggagggcaggagcgctgtcgtggactccgtgtgcttggagagtgtgggcttctgccggagcagcatcctggccgggggccagccacgctggacgcttgccgtgccagggaggggcagcgacgaggttcagattctggagatgccctccaagacgtcagtgtgcgccctgaagccgaaggcagatgccaagctgggcatgcccatgtgcctgcggctgtggcaggccgactgcagctcccgcccactccttctggccggctatgaggatggatcggtggtcctgtgggacgtctctgagcagaaggtgtgcagccgcatcgcctgccatgaggagcccgtcatggaccttgactttgactcccagaaggccaggggcatctcaggctccgcggggaaggcgctggctgtctggagcctggactggcagcaggccctgcaggtgcgtgggactcatgaactcaccaatcccgggatcgccgaggtcacgatccggccagatcgcaagatcctggccaccgcaggctgggaccaccgcatccgcgtgttccactggcggacgatgcagccactggccgtgctggccttccacagcgccgctgtccagtgcgtggccttcaccgccgatggcttgctggccgcgggctccaaggatcagcggatcagcctctggtcactctacccacgcgcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1 - neural precursor cell expressed, developmentally down-regulated 4-like - protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform - transmembrane protein with EGF-like and two follistatin-like domains 1 |