Login to display prices
Login to display prices
GNB1L-guanine nucleotide binding protein (G protein), beta polypeptide 1-like Gene View larger

GNB1L-guanine nucleotide binding protein (G protein), beta polypeptide 1-like Gene

PTXBC012060

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNB1L-guanine nucleotide binding protein (G protein), beta polypeptide 1-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GNB1L-guanine nucleotide binding protein (G protein), beta polypeptide 1-like Gene

Proteogenix catalog: PTXBC012060
Ncbi symbol: GNB1L
Product name: GNB1L-guanine nucleotide binding protein (G protein), beta polypeptide 1-like Gene
Size: 2ug
Accessions: BC012060
Gene id: 54584
Gene description: guanine nucleotide binding protein (G protein), beta polypeptide 1-like
Synonyms: DGCRK3; FKSG1; GY2; WDR14; WDVCF; guanine nucleotide-binding protein subunit beta-like protein 1; G-protein beta subunit-like protein; WD repeat-containing protein 14; WD40 repeat-containing protein deleted in VCFS; g protein subunit beta-like protein 1; guanine nucleotide binding protein (G protein), beta polypeptide 1-like; guanine nucleotide binding protein beta-subunit-like polypeptide; G protein subunit beta 1 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacggccccctgcccgccgccacctccagacccccagtttgtcctccgaggcacccagtcaccggtgcatgcgctgcacttctgcgaaggagcccaggctcaggggcgcccgctcctcttctcagggtctcagagtggcctggtacacatctggagcctgcagacgcggagagcggttaccaccctggatggccacggcggccagtgtgtgacctggctgcagacgctgccccaggggcgccagctcctcagtcagggccgggacctgaagctgtgcctgtgggacctcgcggagggcaggagcgctgtcgtggactccgtgtgcttggagagtgtgggcttctgccggagcagcatcctggccgggggccagccacgctggacgcttgccgtgccagggaggggcagcgacgaggttcagattctggagatgccctccaagacgtcagtgtgcgccctgaagccgaaggcagatgccaagctgggcatgcccatgtgcctgcggctgtggcaggccgactgcagctcccgcccactccttctggccggctatgaggatggatcggtggtcctgtgggacgtctctgagcagaaggtgtgcagccgcatcgcctgccatgaggagcccgtcatggaccttgactttgactcccagaaggccaggggcatctcaggctccgcggggaaggcgctggctgtctggagcctggactggcagcaggccctgcaggtgcgtgggactcatgaactcaccaatcccgggatcgccgaggtcacgatccggccagatcgcaagatcctggccaccgcaggctgggaccaccgcatccgcgtgttccactggcggacgatgcagccactggccgtgctggccttccacagcgccgctgtccagtgcgtggccttcaccgccgatggcttgctggccgcgggctccaaggatcagcggatcagcctctggtcactctacccacgcgcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: