GNB1L-guanine nucleotide binding protein (G protein), beta polypeptide 1-like Gene View larger

GNB1L-guanine nucleotide binding protein (G protein), beta polypeptide 1-like Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNB1L-guanine nucleotide binding protein (G protein), beta polypeptide 1-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GNB1L-guanine nucleotide binding protein (G protein), beta polypeptide 1-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012060
Product type: DNA & cDNA
Ncbi symbol: GNB1L
Origin species: Human
Product name: GNB1L-guanine nucleotide binding protein (G protein), beta polypeptide 1-like Gene
Size: 2ug
Accessions: BC012060
Gene id: 54584
Gene description: guanine nucleotide binding protein (G protein), beta polypeptide 1-like
Synonyms: DGCRK3; FKSG1; GY2; WDR14; WDVCF; guanine nucleotide-binding protein subunit beta-like protein 1; G-protein beta subunit-like protein; WD repeat-containing protein 14; WD40 repeat-containing protein deleted in VCFS; g protein subunit beta-like protein 1; guanine nucleotide binding protein (G protein), beta polypeptide 1-like; guanine nucleotide binding protein beta-subunit-like polypeptide; G protein subunit beta 1 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacggccccctgcccgccgccacctccagacccccagtttgtcctccgaggcacccagtcaccggtgcatgcgctgcacttctgcgaaggagcccaggctcaggggcgcccgctcctcttctcagggtctcagagtggcctggtacacatctggagcctgcagacgcggagagcggttaccaccctggatggccacggcggccagtgtgtgacctggctgcagacgctgccccaggggcgccagctcctcagtcagggccgggacctgaagctgtgcctgtgggacctcgcggagggcaggagcgctgtcgtggactccgtgtgcttggagagtgtgggcttctgccggagcagcatcctggccgggggccagccacgctggacgcttgccgtgccagggaggggcagcgacgaggttcagattctggagatgccctccaagacgtcagtgtgcgccctgaagccgaaggcagatgccaagctgggcatgcccatgtgcctgcggctgtggcaggccgactgcagctcccgcccactccttctggccggctatgaggatggatcggtggtcctgtgggacgtctctgagcagaaggtgtgcagccgcatcgcctgccatgaggagcccgtcatggaccttgactttgactcccagaaggccaggggcatctcaggctccgcggggaaggcgctggctgtctggagcctggactggcagcaggccctgcaggtgcgtgggactcatgaactcaccaatcccgggatcgccgaggtcacgatccggccagatcgcaagatcctggccaccgcaggctgggaccaccgcatccgcgtgttccactggcggacgatgcagccactggccgtgctggccttccacagcgccgctgtccagtgcgtggccttcaccgccgatggcttgctggccgcgggctccaaggatcagcggatcagcctctggtcactctacccacgcgcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1
- neural precursor cell expressed, developmentally down-regulated 4-like
- protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform
- transmembrane protein with EGF-like and two follistatin-like domains 1

Buy GNB1L-guanine nucleotide binding protein (G protein), beta polypeptide 1-like Gene now

Add to cart