Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PPM1A-protein phosphatase 1A (formerly 2C), magnesium-dependent, alpha isoform Gene
PTXBC026691
New product
Data sheet of PPM1A-protein phosphatase 1A (formerly 2C), magnesium-dependent, alpha isoform Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPM1A-protein phosphatase 1A (formerly 2C), magnesium-dependent, alpha isoform Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC026691 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPM1A |
| Origin species: | Human |
| Product name: | PPM1A-protein phosphatase 1A (formerly 2C), magnesium-dependent, alpha isoform Gene |
| Size: | 2ug |
| Accessions: | BC026691 |
| Gene id: | 5494 |
| Gene description: | protein phosphatase 1A (formerly 2C), magnesium-dependent, alpha isoform |
| Synonyms: | PP2C-ALPHA; PP2CA; PP2Calpha; protein phosphatase 1A; protein phosphatase 1A (formerly 2C), magnesium-dependent, alpha isoform; protein phosphatase, Mg2+/Mn2+ dependent 1A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggagcatttttagacaagccaaagatggaaaagcataatgcccaggggcagggtaatgggttgcgatatgggctaagcagcatgcaaggctggcgtgttgaaatggaggatgcacatacggctgtgatcggtttgccaagtggacttgaatcgtggtcattctttgctgtgtatgatgggcatgctggttctcaggttgccaaatactgctgtgagcatttgttagatcacatcaccaataaccaggattttaaagggtctgcaggagcaccttctgtggaaaatgtaaagaatggaatcagaacaggttttctggagattgatgaacacatgagagttatgtcagagaagaaacatggtgcagatagaagtgggtcaacagctgtaggtgtcttaatttctccccaacatacttatttcattaactgtggagactcaagaggtttactttgtaggaacaggaaagttcatttcttcacacaagatcacaaaccaagtaatccgctggagaaagaacgaattcagaatgcaggtggctctgtaatgattcagcgtgtgaatggctctctggctgtatcgagggcccttggggattttgattacaaatgtgtccatggaaaaggtcctactgagcagcttgtctcaccagagcctgaagtccatgatattgaaagatctgaagaagatgatcagttcattatccttgcatgtgatggtatctgggatgttatgggaaatgaagagctctgtgattttgtaagatccagacttgaagtcactgatgaccttgagaaagtttgcaatgaagtagtcgacacctgtttgtataagggaagtcgagacaacatgagtgtgattttgatctgttttccaaatgcacccaaagtatcgccagaagcagtgaagaaggaggcagagttggacaagtacctggaatgcagagtagaagaaatcataaagaagcagggggaaggcgtccccgacttagtccatgtgatgcgcacattagcgagtgagaacatccccagcctcccaccagggggtgaattggcaagcaagaggaatgttattgaagccgtttacaatagactgaatccttacaaaaatgacgacactgactctacatcaacagatgatatgtggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 16, member 7 (monocarboxylic acid transporter 2) - protein phosphatase 3 (formerly 2B), regulatory subunit B, beta isoform - sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 - dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit |