SLC22A11-solute carrier family 22 (organic anion/urate transporter), member 11 Gene View larger

SLC22A11-solute carrier family 22 (organic anion/urate transporter), member 11 Gene

PTXBC034384

New product

Data sheet of SLC22A11-solute carrier family 22 (organic anion/urate transporter), member 11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC22A11-solute carrier family 22 (organic anion/urate transporter), member 11 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC034384
Product type: DNA & cDNA
Ncbi symbol: SLC22A11
Origin species: Human
Product name: SLC22A11-solute carrier family 22 (organic anion/urate transporter), member 11 Gene
Size: 2ug
Accessions: BC034384
Gene id: 55867
Gene description: solute carrier family 22 (organic anion/urate transporter), member 11
Synonyms: OAT4; hOAT4; solute carrier family 22 member 11; organic anion transporter 4; solute carrier family 22 (organic anion/cation transporter), member 11; solute carrier family 22 (organic anion/urate transporter), member 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgttctcgaagctcttggagcaagccggaggcgtgggcctcttccagaccctgcaggtgctcaccttcatcctcccctgcctcatgataccttcccagatgctcctggagaacttctcagccgccatcccaggccaccgatgctggacacacatgctggacaatggctctgcggtttccacaaacatgacccccaaggcccttctgaccatctccatcccgccaggccccaaccaggggccccaccagtgccgccgcttccgccagccacagtggcagctcttggaccccaatgccacggccaccagctggagcgaagctgacacggagccgtgtgtggacggctgggtctatgaccgcagcgtcttcacctccaccatcgtggccaagtgggacctggtgtgcagctcccagggcttgaagcccctaagccagtccatcttcatgtccgggatcctggtgggctcctttatctggggcctcctctcctaccggtttgggaggaagccgatgctgagctggtgctgcctgcagttggccgtggcgggcaccagcaccatcttcgccccaacattcgtcatctactgcggcctgcggttcgtggccgcttttgggatggccggcatctttctgagttcactgacactgatggtggagtggaccacgaccagcaggagggcggtcaccatgacggtggtgggatgtgccttcagcgcaggccaggcggcgctgggcggcctggcctttgccctgcgggactggaggactctccagctggcagcatcagtgcccttctttgccatctccctgatatcctggtggctgccagaatccgcccggtggctgattattaagggcaaaccagaccaagcacttcaggagctcagaaaggtggccaggataaatggccacaaggaggccaagaacctgaccatagaggtgctgatgtccagcgtgaaggaggaggtggcctctgcaaaggagccgcggtcggtgctggacctgttctgcgtgcccgtgctccgctggaggagctgcgccatgctggtggtgaatttctctctattgatctcctactatgggctggtcttcgacctgcagagcctgggccgtgacatcttcctcctccaggccctcttcggggccgtggacttcctgggccgggccaccactgccctcttgctcagtttccttggccgccgcaccatccaggcgggttcccaggccatggccggcctcgccattctagccaacatgctggtgccgcaagatttgcagaccctgcgtgtggtctttgctgtgctgggaaagggatgttttgggataagcctaacctgcctcaccatctacaaggctgaactctttccaacgccagtgcggatgacagcagatggcattctgcatacagtgggccggctgggggctatgatgggtcccctgatcctgatgagccgccaagccctgcccctgctgcctcctctcctctatggcgttatctccattgcttccagcctggttgtgctgttcttcctcccggagacccagggacttccgctccctgacactatccaggacctggagagccagaaatcaacagcagcccagggcaaccggcaagaggccgtcactgtggaaagtacctcgctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast)
- protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform
- glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast)
- E74-like factor 3 (ets domain transcription factor, epithelial-specific )

Buy SLC22A11-solute carrier family 22 (organic anion/urate transporter), member 11 Gene now

Add to cart