Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KCNS2-potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2 Gene
PTXBC027932
New product
Data sheet of KCNS2-potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNS2-potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027932 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNS2 |
| Origin species: | Human |
| Product name: | KCNS2-potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2 Gene |
| Size: | 2ug |
| Accessions: | BC027932 |
| Gene id: | 3788 |
| Gene description: | potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2 |
| Synonyms: | KV9.2; potassium voltage-gated channel subfamily S member 2; delayed-rectifier K(+) channel alpha subunit 2; potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2; voltage-gated potassium channel subunit Kv9.2; potassium voltage-gated channel modifier subfamily S member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccggccagagcctgtgggacgtgtcggaggctaacgtcgaggacggggagatccgcatcaatgtgggcggcttcaagaggaggctgcgctcgcacacgctgctgcgcttccccgagacgcgcctgggccgcttgctgctctgccactcgcgcgaggccattctggagctctgcgatgactacgacgacgtccagcgggagttctacttcgaccgcaaccctgagctcttcccctacgtgctgcatttctatcacaccggcaagcttcacgtcatggctgagctatgtgtcttctccttcagccaggagatcgagtactggggcatcaacgagttcttcattgactcctgctgcagctacagctaccatggccgcaaagtagagcccgagcaggagaagtgggacgagcagagtgaccaggagagcaccacgtcttccttcgatgagatccttgccttctacaacgacgcctccaagttcgatgggcagcccctcggcaacttccgcaggcagctgtggctggcgctggacaaccccggctactcagtgctgagcagggtcttcagcatcctgtccatcctggtggtgatggggtccatcatcaccatgtgcctcaatagcctgcccgatttccaaatccctgacagccagggcaaccctggcgaggaccctaggttcgaaatcgtggagcactttggcattgcctggttcacatttgagctggtggccaggtttgctgtggcccctgacttcctcaagttcttcaagaatgccctaaaccttattgacctcatgtccatcgtccccttttacatcactctggtggtgaacctggtggtggagagcacacctactttagccaacttgggcagggtggcccaggtcctgaggctgatgcggatcttccgcatcttaaagctggccaggcactccactggcctccgctccctgggggccactttgaaatacagctacaaagaagtagggctgctcttgctctacctctccgtggggatttccatcttctccgtggtggcctacaccattgaaaaggaggagaacgagggcctggccaccatccctgcctgctggtggtgggctaccgtcagtatgaccacagtggggtacggggatgtggtcccagggaccacggcaggaaagctgactgcctctgcctgcatcttggcaggcatcctcgtggtggtcctgcccatcaccttgatcttcaataagttctcccacttttaccggcgccaaaagcaacttgagagtgccatgcgcagctgtgactttggagatggaatgaaggaggtcccttcggtcaatttaagggactattatgcccataaagttaaatcccttatggcaagcctgacgaacatgagcaggagctcaccaagtgaactcagtttaaatgattccctacgttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3 - ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide - nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) - solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 |