Login to display prices
Login to display prices
KCNS2-potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2 Gene View larger

KCNS2-potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2 Gene

PTXBC027932

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCNS2-potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KCNS2-potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2 Gene

Proteogenix catalog: PTXBC027932
Ncbi symbol: KCNS2
Product name: KCNS2-potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2 Gene
Size: 2ug
Accessions: BC027932
Gene id: 3788
Gene description: potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2
Synonyms: KV9.2; potassium voltage-gated channel subfamily S member 2; delayed-rectifier K(+) channel alpha subunit 2; potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2; voltage-gated potassium channel subunit Kv9.2; potassium voltage-gated channel modifier subfamily S member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccggccagagcctgtgggacgtgtcggaggctaacgtcgaggacggggagatccgcatcaatgtgggcggcttcaagaggaggctgcgctcgcacacgctgctgcgcttccccgagacgcgcctgggccgcttgctgctctgccactcgcgcgaggccattctggagctctgcgatgactacgacgacgtccagcgggagttctacttcgaccgcaaccctgagctcttcccctacgtgctgcatttctatcacaccggcaagcttcacgtcatggctgagctatgtgtcttctccttcagccaggagatcgagtactggggcatcaacgagttcttcattgactcctgctgcagctacagctaccatggccgcaaagtagagcccgagcaggagaagtgggacgagcagagtgaccaggagagcaccacgtcttccttcgatgagatccttgccttctacaacgacgcctccaagttcgatgggcagcccctcggcaacttccgcaggcagctgtggctggcgctggacaaccccggctactcagtgctgagcagggtcttcagcatcctgtccatcctggtggtgatggggtccatcatcaccatgtgcctcaatagcctgcccgatttccaaatccctgacagccagggcaaccctggcgaggaccctaggttcgaaatcgtggagcactttggcattgcctggttcacatttgagctggtggccaggtttgctgtggcccctgacttcctcaagttcttcaagaatgccctaaaccttattgacctcatgtccatcgtccccttttacatcactctggtggtgaacctggtggtggagagcacacctactttagccaacttgggcagggtggcccaggtcctgaggctgatgcggatcttccgcatcttaaagctggccaggcactccactggcctccgctccctgggggccactttgaaatacagctacaaagaagtagggctgctcttgctctacctctccgtggggatttccatcttctccgtggtggcctacaccattgaaaaggaggagaacgagggcctggccaccatccctgcctgctggtggtgggctaccgtcagtatgaccacagtggggtacggggatgtggtcccagggaccacggcaggaaagctgactgcctctgcctgcatcttggcaggcatcctcgtggtggtcctgcccatcaccttgatcttcaataagttctcccacttttaccggcgccaaaagcaacttgagagtgccatgcgcagctgtgactttggagatggaatgaaggaggtcccttcggtcaatttaagggactattatgcccataaagttaaatcccttatggcaagcctgacgaacatgagcaggagctcaccaagtgaactcagtttaaatgattccctacgttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: