Login to display prices
Login to display prices
PPP2R1B-protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform Gene View larger

PPP2R1B-protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform Gene

PTXBC027596

New product

Data sheet of PPP2R1B-protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPP2R1B-protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC027596
Product type: DNA & cDNA
Ncbi symbol: PPP2R1B
Origin species: Human
Product name: PPP2R1B-protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform Gene
Size: 2ug
Accessions: BC027596
Gene id: 5519
Gene description: protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform
Synonyms: PP2A-Abeta; PR65B; serine/threonine-protein phosphatase 2A 65 kDa regulatory subunit A beta isoform; PP2A, subunit A, PR65-beta isoform; PP2A, subunit A, R1-beta isoform; protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform; protein phosphatase 2, regulatory subunit A, beta; protein phosphatase 2, structural/regulatory subunit A, beta; protein phosphatase 2 scaffold subunit Abeta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgggcgcatcagagctcgggaccggcccaggagcagcgggtggagatggagatgattcgctatacccgatcgcggttttaatcgacgagctccgcaatgaagacgtgcagctccgactcaacagtattaagaagttatcaacaattgccctagcacttggagtagaaaggacccgaagtgaattgttgccatttcttacagatacaatttatgatgaagatgaggtactattagctcttgctgagcagctgggaaatttcactggcctagtgggaggtcctgactttgcccactgtctgctgcctcctttggaaaatctggcaactgtggaagagactgttgttcgtgacaaggctgtggagtccctgagacagatctcccaggagcatactcctgttgctctggaagcttattttgtacctctggtgaaacgcttagcaagtggggattggttcacctctcgcacatctgcatgtggtttgttcagcgtttgctatcccagggcatcaaatgctgttaaagcagaaatcagacagcaattccgttccttgtgctcagatgacacaccaatggtacgacgtgctgctgcttccaaattgggtgaatttgcaaaagttttggaattagacagtgtgaaaagtgaaattgttccactgttcactagtctagcttcagatgaacaggattcagtgcgcctccttgctgtggaagcttgtgtcagtattgcccagttattgtctcaggatgaccttgagactttggtgatgcctacacttcgacaagcagcagaagataaatcttggcgcgttcgctatatggtggctgacagattttcagagctccagaaagccatgggtcctaaaatcaccctaaatgacctcatccccgcctttcagaacctacttaaagactgtgaagctgaagtccgggctgctgctgcccacaaagtaaaagaacttggtgagaacttgcccattgaagatagagagaccataattatgaatcaaattctgccttatataaaggaattagtatccgataccaatcaacatgtcaaatcggctctagcttctgtaattatgggattgtctactattttgggcaaagaaaataccattgaacatcttctacctcttttcttagctcagttaaaggatgagtgtcctgacgttcgtttgaatatcatctccaatttggattgtgtaaatgaagtgattggaatccgtcagctctctcagtctctccttcctgccatagtggagctggcagaagatgccaaatggagggtccgcctggccatcattgagtatatgccgctgctggcaggccagctgggtgtggaattctttgatgaaaagctgaattctttatgtatggcttggctcgtggaccatgtatacgccatccgagaagctgccaccaacaacctcatgaaactagttcagaagtttggtacagagtgggcccaaaatactattgttcccaaagtgttagtaatggcaaatgatcctaattacttgcatagaatgaccactttattctgcattaatgcactgtctgaggcctgtggtcaggaaataactactaagcaaatgctgcccatcgtattaaaaatggcaggagaccaagtagcaaatgttcgcttcaatgtggccaaatctctacaaaagattggaccaattctagataccaatgctttacagggagaagtgaagccagtactacagaagttaggtcaagatgaagacatggatgtcaaatactttgcacaggaagctataagtgtggtggcacaaaggctgaggaagctagaatttcctgtgaaggacagtggagaacccagtgtccctcgggctgacaagaaccacttcccaagacccacagtgcctggagaggacatggggaagggaccagtgtatcagttgcgtggagatactagagacacacttgcccagctgggaattgcagagctagtgcatttctcccaaagcacagactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein phosphatase 3 (formerly 2B), regulatory subunit B, alpha isoform
- solute carrier family 25 (mitochondrial carrier: glutamate), member 22
- protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform
- phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III