Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PPP3R1-protein phosphatase 3 (formerly 2B), regulatory subunit B, alpha isoform Gene
PTXBC027913
New product
Data sheet of PPP3R1-protein phosphatase 3 (formerly 2B), regulatory subunit B, alpha isoform Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPP3R1-protein phosphatase 3 (formerly 2B), regulatory subunit B, alpha isoform Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027913 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPP3R1 |
| Origin species: | Human |
| Product name: | PPP3R1-protein phosphatase 3 (formerly 2B), regulatory subunit B, alpha isoform Gene |
| Size: | 2ug |
| Accessions: | BC027913 |
| Gene id: | 5534 |
| Gene description: | protein phosphatase 3 (formerly 2B), regulatory subunit B, alpha isoform |
| Synonyms: | CALNB1; CNB; CNB1; calcineurin subunit B type 1; calcineurin B, type I (19kDa); protein phosphatase 2B regulatory subunit 1; protein phosphatase 2B regulatory subunit B alpha; protein phosphatase 3 (formerly 2B), regulatory subunit B (19kD), alpha isoform (calcineurin B, type I); protein phosphatase 3 (formerly 2B), regulatory subunit B, 19kDa, alpha isoform (calcineurin B, type I); protein phosphatase 3 (formerly 2B), regulatory subunit B, alpha isoform; protein phosphatase 3 regulatory subunit B, alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggaaatgaggcaagttatcctttggaaatgtgctcacactttgatgcggatgaaattaaaaggctaggaaagagatttaagaagcttgatttggacaattctggttctttgagtgtggaagagttcatgtctctgcctgagttacaacagaatcctttagtacagcgagtaatagatatattcgacacagatgggaatggagaagtagactttaaagaattcattgagggcgtctctcagttcagtgtcaaaggagataaggagcagaaattgaggtttgctttccgtatctatgacatggataaagatggctatatttccaatggggaactcttccaggtattgaagatgatggtggggaacaatctgaaagatacacagttacagcaaattgtagacaaaaccataataaatgcagataaggatggagatggaagaatatcctttgaagaattctgtgctgttgtaggtggcctagatatccacaaaaagatggtggtagatgtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 25 (mitochondrial carrier: glutamate), member 22 - protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform - phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III - potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2 |