Login to display prices
Login to display prices
PLEKHA8-pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 Gene View larger

PLEKHA8-pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 Gene

PTXBC053990

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PLEKHA8-pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PLEKHA8-pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 Gene

Proteogenix catalog: PTXBC053990
Ncbi symbol: PLEKHA8
Product name: PLEKHA8-pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 Gene
Size: 2ug
Accessions: BC053990
Gene id: 84725
Gene description: pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8
Synonyms: FAPP2; pleckstrin homology domain-containing family A member 8; PH domain-containing family A member 8; phosphatidylinositol-four-phosphate adapter protein 2; phosphoinositol 4-phosphate adapter protein 2; pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8; serologically defined breast cancer antigen NY-BR-86; pleckstrin homology domain containing A8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagggggtgctgtacaagtggaccaactatctgagcggttggcagcctcgatggttccttctctgtgggggaatattgtcctattatgattctcctgaagatgcctggaaaggttgcaaagggagcatacaaatggcagtctgtgaaattcaagttcattctgtagataatacacgcatggacctgataatccctggggaacagtatttctacctgaaggccagaagtgtggctgaaagacagcggtggctggtggccctgggatcagccaaggcttgcctgactgacagtaggacccagaaggagaaagagtttgctgaaaacactgaaaacttgaaaaccaaaatgtcagaactaagactctactgtgacctccttgttcagcaagtagataaaacaaaagaagtgaccacaactggtgtgtccaattctgaggagggaattgatgtgggaactttgctgaaatcaacctgtaatacttttctgaagaccttggaagaatgcatgcagatcgcaaatgcagccttcacctctgagctgctctaccgcactccaccaggatcacctcagctggccatgctcaagtccagcaagatgaaacatcctattataccaattcataattcattggaaaggcaaatggagttgagcacttgtgaaaatggatctttaaatatggaaataaatggtgaggaagaaatcctaatgaaaaataagaattccttatatttgaaatctgcagagatagactgcagcatatcaagtgaggaaaatacagatgataatataacagtccaaggtgaaataaggaaggaagatggaatggaaaacctgaaaaatcatgacaataacttgactcagtctggatcagactcaagttgctctccggaatgcctctgggaggaaggcaaagaagttatcccaactttctttagtaccatgaacacaagctttagtgacattgaacttctggaagacagtggcattcccacagaagcattcttggcatcatgttatgctgtggttccagtattagacaaacttggccctacagtgtttgctcctgttaagatggatcttgttggaaatattaagaaagtaaatcagaagtatataaccaacaaagaagagtttaccactctccagaagatagtgctgcacgaagtggaggcggatgtagcccaggttaggaactcagcgactgaagccctcttgtggctgaagagaggtctcaaatttttgaagggatttttgacagaagtgaaaaatggggagaaggatatccagacagccctaaataatgcatatggtaaaacattgcggcaacaccatggctgggtagttcgaggggtttttgcggtgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: