Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PLEKHA8-pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 Gene
PTXBC053990
New product
Data sheet of PLEKHA8-pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PLEKHA8-pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC053990 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PLEKHA8 |
| Origin species: | Human |
| Product name: | PLEKHA8-pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 Gene |
| Size: | 2ug |
| Accessions: | BC053990 |
| Gene id: | 84725 |
| Gene description: | pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 |
| Synonyms: | FAPP2; pleckstrin homology domain-containing family A member 8; PH domain-containing family A member 8; phosphatidylinositol-four-phosphate adapter protein 2; phosphoinositol 4-phosphate adapter protein 2; pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8; serologically defined breast cancer antigen NY-BR-86; pleckstrin homology domain containing A8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagggggtgctgtacaagtggaccaactatctgagcggttggcagcctcgatggttccttctctgtgggggaatattgtcctattatgattctcctgaagatgcctggaaaggttgcaaagggagcatacaaatggcagtctgtgaaattcaagttcattctgtagataatacacgcatggacctgataatccctggggaacagtatttctacctgaaggccagaagtgtggctgaaagacagcggtggctggtggccctgggatcagccaaggcttgcctgactgacagtaggacccagaaggagaaagagtttgctgaaaacactgaaaacttgaaaaccaaaatgtcagaactaagactctactgtgacctccttgttcagcaagtagataaaacaaaagaagtgaccacaactggtgtgtccaattctgaggagggaattgatgtgggaactttgctgaaatcaacctgtaatacttttctgaagaccttggaagaatgcatgcagatcgcaaatgcagccttcacctctgagctgctctaccgcactccaccaggatcacctcagctggccatgctcaagtccagcaagatgaaacatcctattataccaattcataattcattggaaaggcaaatggagttgagcacttgtgaaaatggatctttaaatatggaaataaatggtgaggaagaaatcctaatgaaaaataagaattccttatatttgaaatctgcagagatagactgcagcatatcaagtgaggaaaatacagatgataatataacagtccaaggtgaaataaggaaggaagatggaatggaaaacctgaaaaatcatgacaataacttgactcagtctggatcagactcaagttgctctccggaatgcctctgggaggaaggcaaagaagttatcccaactttctttagtaccatgaacacaagctttagtgacattgaacttctggaagacagtggcattcccacagaagcattcttggcatcatgttatgctgtggttccagtattagacaaacttggccctacagtgtttgctcctgttaagatggatcttgttggaaatattaagaaagtaaatcagaagtatataaccaacaaagaagagtttaccactctccagaagatagtgctgcacgaagtggaggcggatgtagcccaggttaggaactcagcgactgaagccctcttgtggctgaagagaggtctcaaatttttgaagggatttttgacagaagtgaaaaatggggagaaggatatccagacagccctaaataatgcatatggtaaaacattgcggcaacaccatggctgggtagttcgaggggtttttgcggtgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4 - sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 - sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 - potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3 |