PTXBC000214
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000214 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GNB2L1 |
| Origin species: | Human |
| Product name: | GNB2L1-guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 Gene |
| Size: | 2ug |
| Accessions: | BC000214 |
| Gene id: | 10399 |
| Gene description: | guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 |
| Synonyms: | GNB2L1; Gnb2-rs1; H12.3; HLC-7; PIG21; receptor of activated protein C kinase 1; cell proliferation-inducing gene 21 protein; guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1; guanine nucleotide binding protein beta polypeptide 2-like 1; guanine nucleotide-binding protein subunit beta-2-like 1; guanine nucleotide-binding protein subunit beta-like protein 12.3; human lung cancer oncogene 7 protein; lung cancer oncogene 7; proliferation-inducing gene 21; protein homologous to chicken B complex protein, guanine nucleotide binding; receptor of activated protein kinase C 1; receptor for activated C kinase 1 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactgagcagatgacccttcgtggcaccctcaagggccacaacggctgggtaacccagatcgctactaccccgcagttcccggacatgatcctctccgcctctcgagataagaccatcatcatgtggaaactgaccagggatgagaccaactatggaattccacagcgtgctctgcggggtcactcccactttgttagtgatgtggttatctcctcagatggccagtttgccctctcaggctcctgggatggaaccctgcgcctctgggatctcacaacgggcaccaccacgaggcgatttgtgggccataccaaggatgtgctgagtgtggccttctcctctgacaaccggcagattgtctctggatctcgagataaaaccatcaagctatggaataccctgggtgtgtgcaaatacactgtccaggatgagagccactcagagtgggtgtcttgtgtccgcttctcgcccaacagcagcaaccctatcatcgtctcctgtggctgggacaagctggtcaaggtatggaacctggctaactgcaagctgaagaccaaccacattggccacacaggctatctgaacacggtgactgtctctccagatggatccctctgtgcttctggaggcaaggatggccaggccatgttatgggatctcaacgaaggcaaacacctttacacgctagatggtggggacatcatcaacgccctgtgcttcagccctaaccgctactggctgtgtgctgccacaggccccagcatcaagatctgggatttagagggaaagatcattgtagatgaactgaagcaagaagttatcagtaccagcagcaaggcagaaccaccccagtgcacctccctggcctggtctgctgatggccagactctgtttgctggctacacggacaacctggtgcgagtgtggcaggtgaccattggcacacgctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 - protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform - hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing - solute carrier family 6 (neurotransmitter transporter, taurine), member 6 |