TCEB2-transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) Gene View larger

TCEB2-transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) Gene

PTXBC013306

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TCEB2-transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TCEB2-transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013306
Product type: DNA & cDNA
Ncbi symbol: TCEB2
Origin species: Human
Product name: TCEB2-transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) Gene
Size: 2ug
Accessions: BC013306
Gene id: 6923
Gene description: transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B)
Synonyms: TCEB2; SIII; transcription elongation factor B polypeptide 2; RNA polymerase II transcription factor SIII p18 subunit; RNA polymerase II transcription factor SIII subunit B; SIII p18; elongin 18 kDa subunit; elongin, 18-kD subunit; transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B); transcription elongation factor B subunit 2; elongin B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgtgttcctcatgatccggcgccacaagaccaccatcttcacggacgccaaggagtccagcacggtgttcgaactgaagcgcatcgtcgagggcatcctcaagcggcctcctgacgagcagcggctgtacaaggatgaccaactcttggatgatggcaagacactgggcgagtgtggcttcaccagtcaaacagcacggccacaggccccagccacagtggggctggccttccgggcagatgacacctttgaggccctgtgcatcgagccgttttccagcccgccagagctgcccgatgtgatgaagccccaggactcgggaagcagtgccaatgaacaagccgtgcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nudix (nucleoside diphosphate linked moiety X)-type motif 9 pseudogene 1
- protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)
- sterol-C5-desaturase (ERG3 delta-5-desaturase homolog, S. cerevisiae)-like
- aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase

Buy TCEB2-transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) Gene now

Add to cart