MYEOV-myeloma overexpressed (in a subset of t(11,14) positive multiple myelomas) Gene View larger

MYEOV-myeloma overexpressed (in a subset of t(11,14) positive multiple myelomas) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MYEOV-myeloma overexpressed (in a subset of t(11,14) positive multiple myelomas) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MYEOV-myeloma overexpressed (in a subset of t(11,14) positive multiple myelomas) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011815
Product type: DNA & cDNA
Ncbi symbol: MYEOV
Origin species: Human
Product name: MYEOV-myeloma overexpressed (in a subset of t(11,14) positive multiple myelomas) Gene
Size: 2ug
Accessions: BC011815
Gene id: 26579
Gene description: myeloma overexpressed (in a subset of t(11;14) positive multiple myelomas)
Synonyms: OCIM; myeloma-overexpressed gene protein; myeloma overexpressed (in a subset of t(11;14) positive multiple myelomas); myeloma overexpressed gene (in a subset of t(11;14) positive multiple myelomas); oncogene in multiple myeloma; myeloma overexpressed
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccctcagaatctgcgtcacatacaccccagctctcccgataggtctctgcactcgctgttgcctctgcctggaacagtctccctcctggtgtcattgtctccgtggtgtgtccttcctgaccttccacctccaccagtctgtcccccttggggacagggactcgttgctcatgttcacccggcaggctggacacttcgtggagggctccaaagctggcagatcccggggccgcctctgtctctcccaggccctgcgtgttgcggtgagaggagcatttgtgtctctgtggtttgctgctggagctggtgaccgggagagaaacaagggagacaagggtgcccagacaggtgcggggctcagccaggaggcagaagacgtggacgtgtcccgggccaggagggtcacagatgcaccacaaggcactctgtgtggcactgggaacaggaattctgggagtcagtctgcaagggcggtgggcgttgctcacctgggagaagcctttagagtgggcgttgagcaggccattagctcgtgccctgaggaggtgcatgggcggcatgggctctccatggaaattatgtgggcgcgaatggatgtggctctgcgctcacctgggcgaggacttctggccggtgccggggcactctgcgtgaccctggcagaatcgagctgccctgactatgaaaggggaagaagagcatgcctgaccctccaccggcaccccacccctcactgctccacctggggcctgcctctgcgggtggctgggtcctggctgactgttgtgactgttgaggccctgggggggtggcgcatgggagttaggaggactggccaggtggggcccactatgcacccacccccagtgtcaggtgcttctcctctcctcctccaccacctcctcctcctcctcctcatcatcatcctcacttgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform
- transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)
- transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B)
- nudix (nucleoside diphosphate linked moiety X)-type motif 9 pseudogene 1

Buy MYEOV-myeloma overexpressed (in a subset of t(11,14) positive multiple myelomas) Gene now

Add to cart