Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MYEOV-myeloma overexpressed (in a subset of t(11,14) positive multiple myelomas) Gene
PTXBC011815
New product
Data sheet of MYEOV-myeloma overexpressed (in a subset of t(11,14) positive multiple myelomas) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MYEOV-myeloma overexpressed (in a subset of t(11,14) positive multiple myelomas) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011815 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MYEOV |
| Origin species: | Human |
| Product name: | MYEOV-myeloma overexpressed (in a subset of t(11,14) positive multiple myelomas) Gene |
| Size: | 2ug |
| Accessions: | BC011815 |
| Gene id: | 26579 |
| Gene description: | myeloma overexpressed (in a subset of t(11;14) positive multiple myelomas) |
| Synonyms: | OCIM; myeloma-overexpressed gene protein; myeloma overexpressed (in a subset of t(11;14) positive multiple myelomas); myeloma overexpressed gene (in a subset of t(11;14) positive multiple myelomas); oncogene in multiple myeloma; myeloma overexpressed |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccctcagaatctgcgtcacatacaccccagctctcccgataggtctctgcactcgctgttgcctctgcctggaacagtctccctcctggtgtcattgtctccgtggtgtgtccttcctgaccttccacctccaccagtctgtcccccttggggacagggactcgttgctcatgttcacccggcaggctggacacttcgtggagggctccaaagctggcagatcccggggccgcctctgtctctcccaggccctgcgtgttgcggtgagaggagcatttgtgtctctgtggtttgctgctggagctggtgaccgggagagaaacaagggagacaagggtgcccagacaggtgcggggctcagccaggaggcagaagacgtggacgtgtcccgggccaggagggtcacagatgcaccacaaggcactctgtgtggcactgggaacaggaattctgggagtcagtctgcaagggcggtgggcgttgctcacctgggagaagcctttagagtgggcgttgagcaggccattagctcgtgccctgaggaggtgcatgggcggcatgggctctccatggaaattatgtgggcgcgaatggatgtggctctgcgctcacctgggcgaggacttctggccggtgccggggcactctgcgtgaccctggcagaatcgagctgccctgactatgaaaggggaagaagagcatgcctgaccctccaccggcaccccacccctcactgctccacctggggcctgcctctgcgggtggctgggtcctggctgactgttgtgactgttgaggccctgggggggtggcgcatgggagttaggaggactggccaggtggggcccactatgcacccacccccagtgtcaggtgcttctcctctcctcctccaccacctcctcctcctcctcctcatcatcatcctcacttgttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform - transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) - transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) - nudix (nucleoside diphosphate linked moiety X)-type motif 9 pseudogene 1 |