CINP-cyclin-dependent kinase 2-interacting protein Gene View larger

CINP-cyclin-dependent kinase 2-interacting protein Gene

PTXBC000600

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CINP-cyclin-dependent kinase 2-interacting protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CINP-cyclin-dependent kinase 2-interacting protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000600
Product type: DNA & cDNA
Ncbi symbol: CINP
Origin species: Human
Product name: CINP-cyclin-dependent kinase 2-interacting protein Gene
Size: 2ug
Accessions: BC000600
Gene id: 51550
Gene description: cyclin-dependent kinase 2-interacting protein
Synonyms: cyclin-dependent kinase 2-interacting protein; CDK2-interacting protein; cyclin dependent kinase 2 interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagcaaagactcttggaactgtaacgcccagaaaacctgtcttatctgtcagtgcaagaaaaattaaggacaatgcggctgattggcacaatttaatcctgaagtgggaaaccctcaatgatgcaggttttaccactgcaaataatattgccaacttgaaaatcagtttattgaataaagacaagatagaactagacagcagcagcccagcctcgaaggaaaatgaagaaaaggtgtgtctggaatataacgaggaactggagaagctgtgtgaggaactgcaggccaccttggatgggttgaccaaaatacaggtgaaaatggaaaagctgtcttcaactaccaagggaatttgtgaactagaaaactaccattatggggaggagagtaaacgaccccctctgttccacacgtggcctacaacccatttctatgaggtttcgcataagctcttggagatgtacaggaaggagctgctcctgaagcgcacggtggccaaggagcttgcccacaccggggatcccgacctcaccctgagctacctgtccatgtggctgcaccagccctatgtggagagcgacagtaggctgcatctggagagcatgctgctggagacaggccaccgagctctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serine/threonine/tyrosine interacting protein
- cell growth regulator with EF-hand domain 1
- ring finger and FYVE-like domain containing 1
- branched chain ketoacid dehydrogenase kinase

Buy CINP-cyclin-dependent kinase 2-interacting protein Gene now

Add to cart