STYX-serine/threonine/tyrosine interacting protein Gene View larger

STYX-serine/threonine/tyrosine interacting protein Gene

PTXBC020265

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STYX-serine/threonine/tyrosine interacting protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about STYX-serine/threonine/tyrosine interacting protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020265
Product type: DNA & cDNA
Ncbi symbol: STYX
Origin species: Human
Product name: STYX-serine/threonine/tyrosine interacting protein Gene
Size: 2ug
Accessions: BC020265
Gene id: 6815
Gene description: serine/threonine/tyrosine interacting protein
Synonyms: serine/threonine/tyrosine-interacting protein; protein tyrosine phosphatase-like protein; serine/threonine/tyrosine interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggacgtgaagctggagttcccttcccttccacagtgcaaggaagacgccgaggagtggacctaccctatgagacgagagatgcaggaaattttacctggattgttcttaggcccatattcatctgctatgaaaagcaagctacctgtactacagaaacatggaataacccatataatatgcatacgacaaaatattgaagcaaactttattaaaccaaactttcagcagttatttagatatttagtcctggatattgcagataatccagttgaaaatataatacgttttttccctatgactaaggaatttattgatgggagcttacaaatgggaggaaaagttcttgtgcatggaaatgcagggatctccagaagtgcagcctttgttattgcatacattatggaaacatttggaatgaagtacagagatgcttttgcttatgttcaagaaagaagattttgtattaatcctaatgctggatttgtccatcaacttcaggaatatgaagccatctacctagcaaaattaacaatacagatgatgtcaccactccagatagaaaggtcattatctgttcattctggtaccacaggcagtttgaagagaacacatgaagaagaggatgattttggaaccatgcaagtggcgactgcacagaatggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cell growth regulator with EF-hand domain 1
- ring finger and FYVE-like domain containing 1
- branched chain ketoacid dehydrogenase kinase
- DnaJ (Hsp40) homolog, subfamily B, member 4

Buy STYX-serine/threonine/tyrosine interacting protein Gene now

Add to cart