Login to display prices
Login to display prices
STYX-serine/threonine/tyrosine interacting protein Gene View larger

STYX-serine/threonine/tyrosine interacting protein Gene

PTXBC020265

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STYX-serine/threonine/tyrosine interacting protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about STYX-serine/threonine/tyrosine interacting protein Gene

Proteogenix catalog: PTXBC020265
Ncbi symbol: STYX
Product name: STYX-serine/threonine/tyrosine interacting protein Gene
Size: 2ug
Accessions: BC020265
Gene id: 6815
Gene description: serine/threonine/tyrosine interacting protein
Synonyms: serine/threonine/tyrosine-interacting protein; protein tyrosine phosphatase-like protein; serine/threonine/tyrosine interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggacgtgaagctggagttcccttcccttccacagtgcaaggaagacgccgaggagtggacctaccctatgagacgagagatgcaggaaattttacctggattgttcttaggcccatattcatctgctatgaaaagcaagctacctgtactacagaaacatggaataacccatataatatgcatacgacaaaatattgaagcaaactttattaaaccaaactttcagcagttatttagatatttagtcctggatattgcagataatccagttgaaaatataatacgttttttccctatgactaaggaatttattgatgggagcttacaaatgggaggaaaagttcttgtgcatggaaatgcagggatctccagaagtgcagcctttgttattgcatacattatggaaacatttggaatgaagtacagagatgcttttgcttatgttcaagaaagaagattttgtattaatcctaatgctggatttgtccatcaacttcaggaatatgaagccatctacctagcaaaattaacaatacagatgatgtcaccactccagatagaaaggtcattatctgttcattctggtaccacaggcagtttgaagagaacacatgaagaagaggatgattttggaaccatgcaagtggcgactgcacagaatggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: