C9orf95-chromosome 9 open reading frame 95 Gene View larger

C9orf95-chromosome 9 open reading frame 95 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C9orf95-chromosome 9 open reading frame 95 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C9orf95-chromosome 9 open reading frame 95 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001366
Product type: DNA & cDNA
Ncbi symbol: C9orf95
Origin species: Human
Product name: C9orf95-chromosome 9 open reading frame 95 Gene
Size: 2ug
Accessions: BC001366
Gene id: 54981
Gene description: chromosome 9 open reading frame 95
Synonyms: C9orf95; NRK1; bA235O14.2; nicotinamide riboside kinase 1; NRK 1; RNK 1; nicotinic acid riboside kinase 1; nmR-K 1; ribosylnicotinamide kinase 1; ribosylnicotinic acid kinase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaaacatttatcattggaatcagtggtgtgacaaacagtggcaaaacaacactggctaagaatttgcagaaacacctcccaaattgcagtgtcatatctcaggatgatttcttcaagccagagtctgagatagagacagataaaaatggatttttgcagtacgatgtgcttgaagcacttaacatggaaaaaatgatgtcagccatttcctgctggatggaaagcgcaagacactctgtggtatcaacagaccaggaaagtgctgaggaaattcccattttaatcatcgaaggttttcttctttttaattataagccccttgacactatatggaatagaagctatttcctgacgattccatatgaagaatgtaaaaggaggaggagtacaagggtctatcagcctccagactctccgggatactttgatggccatgtgtggcccatgtatctaaagtacagacaagaaatgcaggacatcacatgggaagttgtgtacctggatggaacaaaatctgaagaggacctctttttgcaagtatatgaagatctaatacaagaactagcaaagcaaaagtgtttgcaagtgacagcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 83
- golgi SNAP receptor complex member 2
- mitochondrial ribosomal protein S35
- mitochondrial ribosomal protein L16

Buy C9orf95-chromosome 9 open reading frame 95 Gene now

Add to cart