IL11-interleukin 11 Gene View larger

IL11-interleukin 11 Gene

PTXBC012506

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IL11-interleukin 11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IL11-interleukin 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012506
Product type: DNA & cDNA
Ncbi symbol: IL11
Origin species: Human
Product name: IL11-interleukin 11 Gene
Size: 2ug
Accessions: BC012506
Gene id: 3589
Gene description: interleukin 11
Synonyms: AGIF; interleukin-11; adipogenesis inhibitory factor; oprelvekin; interleukin 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaactgtgtttgccgcctggtcctggtcgtgctgagcctgtggccagatacagctgtcgcccctgggccaccacctggcccccctcgagtttccccagaccctcgggccgagctggacagcaccgtgctcctgacccgctctctcctggcggacacgcggcagctggctgcacagctgagggacaaattcccagctgacggggaccacaacctggattccctgcccaccctggccatgagtgcgggggcactgggagctctacagctcccaggtgtgctgacaaggctgcgagcggacctactgtcctacctgcggcacgtgcagtggctgcgccgggcaggtggctcttccctgaagaccctggagcccgagctgggcaccctgcaggcccgactggaccggctgctgcgccggctgcagctcctgatgtcccgcctggccctgccccagccacccccggacccgccggcgcccccgctggcgcccccctcctcagcctgggggggcatcagggccgccctcgccatcctgggggggctgcacctgacacttgactgggccgtgaggggactgctgctgctgaagactcggctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transgelin 2
- CXXC finger 5
- mohawk homeobox
- astrotactin 2

Buy IL11-interleukin 11 Gene now

Add to cart