DUSP14-dual specificity phosphatase 14 Gene View larger

DUSP14-dual specificity phosphatase 14 Gene

PTXBC000370

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DUSP14-dual specificity phosphatase 14 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DUSP14-dual specificity phosphatase 14 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000370
Product type: DNA & cDNA
Ncbi symbol: DUSP14
Origin species: Human
Product name: DUSP14-dual specificity phosphatase 14 Gene
Size: 2ug
Accessions: BC000370
Gene id: 11072
Gene description: dual specificity phosphatase 14
Synonyms: MKP-L; dual specificity protein phosphatase 14; MAP kinase phosphatase 6; MKP-1-like protein tyrosine phosphatase; MKP-6; mitogen-activated protein kinase phosphatase 6; dual specificity phosphatase 14
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagctccagaggtcacagcacgctaccaaggactctcatggcccctcggatgatttccgagggagacataggaggcattgctcaaatcacctcctctctattcctgggcagaggcagtgtggcctccaatcggcacctcctccaggctcgtggcatcacctgcattgttaatgctaccattgagatccctaatttcaactggccccaatttgagtatgttaaagtgcctctggctgacatgccgcatgcccccattggactgtactttgacaccgtggctgacaagatccacagtgtgagcaggaagcacggggccaccttggtgcactgtgctgcaggggtgagccgctcagccacgctgtgtatcgcgtacctgatgaaattccacaacgtgtgcctgctggaggcgtacaactgggtgaaagcccggcgacctgtcatcaggcccaacgtaggcttctggaggcaactgatagactacgagcgccagctctttgggaagtcgacagttaaaatggtacagacaccttatggcatagttcccgacgtctatgagaaggagtcccgacacctgatgccttactgggggatttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - delta-like 2 homolog (Drosophila)
- cell division cycle associated 4
- cell division cycle associated 3
- collectin sub-family member 11

Buy DUSP14-dual specificity phosphatase 14 Gene now

Add to cart