Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of DUSP14-dual specificity phosphatase 14 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DUSP14-dual specificity phosphatase 14 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000370 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DUSP14 |
| Origin species: | Human |
| Product name: | DUSP14-dual specificity phosphatase 14 Gene |
| Size: | 2ug |
| Accessions: | BC000370 |
| Gene id: | 11072 |
| Gene description: | dual specificity phosphatase 14 |
| Synonyms: | MKP-L; dual specificity protein phosphatase 14; MAP kinase phosphatase 6; MKP-1-like protein tyrosine phosphatase; MKP-6; mitogen-activated protein kinase phosphatase 6; dual specificity phosphatase 14 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagctccagaggtcacagcacgctaccaaggactctcatggcccctcggatgatttccgagggagacataggaggcattgctcaaatcacctcctctctattcctgggcagaggcagtgtggcctccaatcggcacctcctccaggctcgtggcatcacctgcattgttaatgctaccattgagatccctaatttcaactggccccaatttgagtatgttaaagtgcctctggctgacatgccgcatgcccccattggactgtactttgacaccgtggctgacaagatccacagtgtgagcaggaagcacggggccaccttggtgcactgtgctgcaggggtgagccgctcagccacgctgtgtatcgcgtacctgatgaaattccacaacgtgtgcctgctggaggcgtacaactgggtgaaagcccggcgacctgtcatcaggcccaacgtaggcttctggaggcaactgatagactacgagcgccagctctttgggaagtcgacagttaaaatggtacagacaccttatggcatagttcccgacgtctatgagaaggagtcccgacacctgatgccttactgggggatttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - delta-like 2 homolog (Drosophila) - cell division cycle associated 4 - cell division cycle associated 3 - collectin sub-family member 11 |