Login to display prices
Login to display prices
RHOA-ras homolog gene family, member A Gene View larger

RHOA-ras homolog gene family, member A Gene

PTXBC001360

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RHOA-ras homolog gene family, member A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RHOA-ras homolog gene family, member A Gene

Proteogenix catalog: PTXBC001360
Ncbi symbol: RHOA
Product name: RHOA-ras homolog gene family, member A Gene
Size: 2ug
Accessions: BC001360
Gene id: 387
Gene description: ras homolog gene family, member A
Synonyms: small GTP binding protein RhoA; transforming protein RhoA; ARH12; ARHA; RHO12; RHOH12; Aplysia ras-related homolog 12; oncogene RHO H12; ras homolog family member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgccatccggaagaaactggtgattgttggtgatggagcctgtggaaagacatgcttgctcatagtcttcagcaaggaccagttcccagaggtgtatgtgcccacagtgtttgagaactatgtggcagatatcgaggtggatggaaagcaggtagagttggctttgtgggacacagctgggcaggaagattatgatcgcctgaggcccctctcctacccagataccgatgttatactgatgtgtttttccatcgacagccctgatagtttagaaaacatcccagaaaagtggaccccagaagtcaagcatttctgtcccaacgtgcccatcatcctggttgggaataagaaggatcttcggaatgatgagcacacaaggcgggagctagccaagatgaagcaggagccggtgaaacctgaagaaggcagagatatggcaaacaggattggcgcttttgggtacatggagtgttcagcaaagaccaaagatggagtgagagaggtttttgaaatggctacgagagctgctctgcaagctagacgtgggaagaaaaaatctgggtgccttgtcttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: