RGS3-regulator of G-protein signaling 3 Gene View larger

RGS3-regulator of G-protein signaling 3 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RGS3-regulator of G-protein signaling 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RGS3-regulator of G-protein signaling 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018072
Product type: DNA & cDNA
Ncbi symbol: RGS3
Origin species: Human
Product name: RGS3-regulator of G-protein signaling 3 Gene
Size: 2ug
Accessions: BC018072
Gene id: 5998
Gene description: regulator of G-protein signaling 3
Synonyms: C2PA; RGP3; regulator of G-protein signaling 3; regulator of G-protein signalling 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctccgaggcatgtacctcactcgcaacgggaacctgcagaggcgacacacgatgaaggaagccaaggacatgaagaacaagctggggatcttcagacggcggagtgagtcccctggagcccctcccgcgggcaaggcagacaaaatgatgaagtcattcaagcccacctcagaggaagccctcaagtggggcgagtccttggagaagctgctggttcacaaatacgggttagcagtgttccaagccttccttcgcactgagttcagtgaggagaatctggagttctggttggcttgtgaggacttcaagaaggtcaagtcacagtccaagatggcatccaaggccaagaagatctttgctgaatacatcgcgatccaggcatgcaaggaggtcaacctggactcctacacgcgggagcacaccaaggacaacctgcagagcgtcacgcggggctgcttcgacctggcacagaagcgcatcttcgggctcatggaaaaggactcgtaccctcgctttctccgttctgacctctacctggaccttattaaccagaagaagatgagtcccccgctttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - abhydrolase domain containing 13
- coiled-coil domain containing 69
- RAB1A, member RAS oncogene family
- regulator of G-protein signaling 4

Buy RGS3-regulator of G-protein signaling 3 Gene now

Add to cart