ZNF747-zinc finger protein 747 Gene View larger

ZNF747-zinc finger protein 747 Gene

PTXBC001361

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF747-zinc finger protein 747 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF747-zinc finger protein 747 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001361
Product type: DNA & cDNA
Ncbi symbol: ZNF747
Origin species: Human
Product name: ZNF747-zinc finger protein 747 Gene
Size: 2ug
Accessions: BC001361
Gene id: 65988
Gene description: zinc finger protein 747
Synonyms: KRAB domain-containing protein ZNF747; zinc finger protein 747
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccgatccgtcgctggggctgacagtccccatggcgccgcctctggccccgctccctccccgggacccaaacggggcgggatccgagtggagaaagcccggggccgtgagcttcgccgacgtggccgtgtacttctcccgggaggagtggggctgcctgcggcccgcgcagagggccctgtaccgggacgtgatgcgggagacctacggccacctgggcgcgctcggtgagagccccacctgcttgcctgggccctgcgcctccacaggccctgccgcgcctctgggagctgcgtgtggagttgggggccccggggccgggcaggcggcctcctcgcagcgtggggtttgcgttcttctcccccaggagtcggaggcagcaagccggcgctcatctcctgggtggaggagaaggccgaactgtgggatccggctgcccaggatccggaggtggcgaagtgtccgacagaagcggacccagcagattccagaaacaaggaagaggaaagacaaagggaagggacgggagccctggagaagcccgaccctgtggccgccgggtctcctgggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 581
- zinc finger protein 581
- HCLS1 binding protein 3
- THAP domain containing 6

Buy ZNF747-zinc finger protein 747 Gene now

Add to cart