Login to display prices
Login to display prices
ZNF747-zinc finger protein 747 Gene View larger

ZNF747-zinc finger protein 747 Gene

PTXBC001361

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF747-zinc finger protein 747 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF747-zinc finger protein 747 Gene

Proteogenix catalog: PTXBC001361
Ncbi symbol: ZNF747
Product name: ZNF747-zinc finger protein 747 Gene
Size: 2ug
Accessions: BC001361
Gene id: 65988
Gene description: zinc finger protein 747
Synonyms: KRAB domain-containing protein ZNF747; zinc finger protein 747
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccgatccgtcgctggggctgacagtccccatggcgccgcctctggccccgctccctccccgggacccaaacggggcgggatccgagtggagaaagcccggggccgtgagcttcgccgacgtggccgtgtacttctcccgggaggagtggggctgcctgcggcccgcgcagagggccctgtaccgggacgtgatgcgggagacctacggccacctgggcgcgctcggtgagagccccacctgcttgcctgggccctgcgcctccacaggccctgccgcgcctctgggagctgcgtgtggagttgggggccccggggccgggcaggcggcctcctcgcagcgtggggtttgcgttcttctcccccaggagtcggaggcagcaagccggcgctcatctcctgggtggaggagaaggccgaactgtgggatccggctgcccaggatccggaggtggcgaagtgtccgacagaagcggacccagcagattccagaaacaaggaagaggaaagacaaagggaagggacgggagccctggagaagcccgaccctgtggccgccgggtctcctgggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: